Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 8H INDENO 1 2 D THIAZOL 2 AMINE HYDROBROMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 2% B27 (Gibco) and 0.25 μg/mL Amphotericin B (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-mercaptoethanol (Gibco) and hygromycin B (InvivoGen ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% B27 (Invitrogen), 100 units/mL penicillin and 100 mcg/mL streptomycin and 0.5 mM glutamine ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2% CSFBS (Gibco), and 1% sodium pyruvate (Gibco ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2% CSFBS (Gibco), 1% sodium pyruvate (Gibco) ...
-
bioRxiv - Systems Biology 2022Quote: ... 2% B27 (Gibco) and 0.2% N-acetyl-cysteine (Gibco)] with the addition of 50ng/ml EGF (Peprotech) ...
-
bioRxiv - Immunology 2023Quote: ... 2% FCS (Gibco), 25 mM HEPES (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% FBS (Gibco), 1% HEPES (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B27 (Gibco) and 1% penicillin and streptomycin with 2 mM glutamine (Life Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2% B27 (Invitrogen), 0.35 g/L NaHCO3 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2% B27 (Gibco), 1% N2(DMEM:F12 (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% B27 (GIBCO), 1% GlutMax (GIBCO) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% B27 (GIBCO), 1% GlutMax (GIBCO) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2% B27 (Gibco), 1% non-essential amino acids (NEAA ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% B27 (Gibco), and 0.1 mg/ml Primocin (Invivogen) ...
-
bioRxiv - Biophysics 2023Quote: ... 2% B27 (Gibco), 0.02 mg/ml insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... B27 (2%, Invitrogen), 2% horse serum) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2% B27 (ThermoFisher) was used in place of FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% B27 (GIBCO), 1% N2 supplement (GIBCO) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2-Mercaptoethanol (Gibco), B-27 supplement 50x (Gibco) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2% B27 (Gibco), 1% N2 (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) staining for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 2°: goat anti-mouse AF488 (1:500) (Invitrogen, A-11001), and donkey anti-rabbit Cy5 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... and ethidium homodimer-1 (2 mM in DMSO, L3224, ThermoFisher) were added directly to the cell medium to a final concentration of 1 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... stained with Neurotrace for 2 hours (1:500, N21479; Invitrogen), rinsed twice with 2x SSCT and mounted on a slide with Fluoromount-G ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... N-2 supplement (1:200; catalog number 17502-048; Invitrogen), 20 ng/ml fibroblast growth factor (catalog number 4114-TC-01M ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were loaded with 1 μM fura-2 AM (Invitrogen) for 40 min before the measurements at 37°C ...
-
bioRxiv - Systems Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1× MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal mounting media (Thermofisher, 8312-4) was placed on each slide ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-Cadherin (Invitrogen clone ECCD-2, 1:500), rabbit anti-PH3 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... 4,6-diamino-2-phenylindole (DAPI) dihydrochloride (1:10,000, Life Technologies) was used to counterstain the nucleus/chromosomes ...