Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... the dissociated DA neurons were incubated with 3 μM Fluo-4 AM (Thermo Fisher, USA, F14201) for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mL of the homogenized suspension was treated with 3 units/mL Rnase-free Dnase (Ambion) for one hour at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... during a 3-day culture followed by 4 days of incubation with 10% FBS (Invitrogen, USA) as previously described[43] ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Genomics 2023Quote: ... at 4°C for 3 hours followed by addition of 10 ml Protein A Dynabeads (Invitrogen) for 20 min to capture the antibody-protein complexes ...
-
bioRxiv - Cell Biology 2024Quote: ... and then for 3-4 h with 50 μM Click-iT® HPG (L-Homopropargylglycine) (Invitrogen). For gel electrophoresis analysis ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were labelled with 10 μM 5-bromo-2′-deoxyuridine (BrdU) (Thermo Fisher Scientific, Cat. #: B23151) for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were centrifuged (300rcf, 7min, 4°C) and fixed (1h, 4°C) using the eBioscience Foxp3/Transcription factor staining buffer set (ThermoFisher #00-5523-00) fixation/permeabilization reagent ...
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... were quantified in autaptic neuronal cultures using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43, Thermo Fisher Scientific, Waltham, MA, USA), similarly as in our previous report (Kawano et al. ...
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Neuroscience 2023Quote: ... were visualized using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43FX, a fixable analog of FM1-43 membrane stain, Thermo Fisher Scientific, Waltham, MA, USA). To stain the presynaptically active synapses of autaptic cultured neurons ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Developmental Biology 2019Quote: ... chilled on ice for 5 min and electrophoresed in a 3 – 8% Tris-Acetate NuPAGE gel (Novex Life Technologies). Transfer of the proteins onto a nitrocellulose membrane was done in transfer buffer (5% methanol ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5 min and loaded into a NuPAGE 3-8% Tris-Acetate Gel (Thermo Scientific) along with HiMark™ Pre-stained Protein Standard (Thermo Scientific LC5699) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Genomics 2023Quote: ... and extracted total RNA using BCP (1-bromo-3-chloropropane; Life Technologies, Thermo Fisher Scientific, Inc., Waltham, MA, USA) with isopropanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3%-8% NuPAGE Tris-Acetate Protein Gels (Thermo Fisher Scientific) for high molecular weight proteins ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Gradient gels (3% - 8% Tris-acetate protein gels, Thermo Fisher Scientific) were loaded with the lysates and run for 55 min at 150 V in Tris-tricine buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... In a NuPAGE 3-8 % Tris-Acetate gel (NOVEX Life Technologies), 15 μg protein was loaded with 5 x loading buffer (0.05 % Bromophenol Blue ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were resolved by Tris-acetate NOVEX NuPAGE 3-8% (Invitrogen) (SorLAFL and SorLA2131 ...
-
bioRxiv - Molecular Biology 2022Quote: ... IP samples were analyzed on 3–8% tris-glycine gels (Invitrogen). Additionally ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein lysates were resolved on 3-8% (Thermo Fisher Scientific EA0375BOX) or 4-12% gradient SDS-PAGE gels (Thermo Fisher Scientific NP0321BOX) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A431RON (Figure 3A-B and 4) or A431RON-K1114M (Figure S3B) cells were seeded in 8-well chamber slides (Nunc Lab-Tek) at a density of 30,000/well and allowed to adhere overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...