Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 8 5 6 7 DIHYDRO 2 4 DIPHENYL 5H 1 BENZOPYRAN 8 YL 2 4 PENTADIENYLIDENE 5 6 7 8 TETRAHYDRO 2 4 DIPHENYL 1 BENZOPYRYLIUM TETRAFLUOROBORATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... All samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize nuclei ...
-
bioRxiv - Biophysics 2020Quote: ... 0.2 mg/ml sufosuccinimidyl-6-(4’-azido-2’-nitrophenylamino)-hexanoate (Sulfo-SANPAH, Thermo Scientific) solution in HEPES buffer (50 mM HEPES at pH 8.5 ...
-
Stromal transdifferentiation drives lymph node lipomatosis and induces extensive vascular remodelingbioRxiv - Pathology 2022Quote: ... For nuclear counterstaining the tissues incubated in 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen) for 5min and the slides were mounted with ProLongGold (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and nuclei were detected using 300 nM 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen), with washes in PBS ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The fluorescent nuclear stain 4’,6-diamidino-2-phenylindole (DAPI) was also from ThermoFisher.
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, #D1306), and images were captured with LSM 880 confocal (Carl Zeiss ...
-
bioRxiv - Bioengineering 2023Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) lactate salt were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genomics 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (0.1 mg/mL in PBS, Invitrogen, cat. D1306) was used to visualize nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stained with DAPI (4′,6-diamidino-2-phenylindole; D1306, Thermo Fisher Scientific) prior to mounting (10-15 min at RT) ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were mounted using SlowFade Gold with 4′,6′-diamidino-2-phenylindole (DAPI) (Invitrogen). Samples were analysed with an inverted Olympus IX81 widefield microscope ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher), 20 μg ml-1 AlexaFluor 488-labeled peanut (Arachis hypogaea ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher) diluted in blocking buffer for 2 hr at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... ProLong® Gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen #P36931) was added to each slide ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher), and/or 20 μg ml-1 AlexaFluor 488-labeled peanut (Arachis hypogaea ...
-
bioRxiv - Molecular Biology 2024Quote: ... ProLong Diamond 4′,6-diamidino-2-phenylindole (DAPI) (cat# P36962) was purchased from Invitrogen. For the calcium influx assay using spinning disc microscopy ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were either stained with 4’,6-diamidino-2-phenylindole (DAPI) FluoroPure grade (Invitrogen) and mounted using Fluoromount aqueous mounting medium (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclear counterstaining was performed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, #D1306, Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclear counterstaining was performed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, #D1306, Invitrogen).
-
bioRxiv - Bioengineering 2024Quote: ... calcein AM and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher) diluted in blocking buffer for 2 hr at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were stained with 300 nM 4’,6-diamidino-2-phenylindole (DAPI; D1306, Invitrogen) for 5 min at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were rinsed in DPBS and incubated with 2 μg/ml DAPI (4′,6-diamidino-2-phenylindole, 62248; ThermoFisher) and 1:500 Alexa Fluor Plus 647 conjugated goat anti-rabbit secondary antibodies (A32733 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell nuclei were counter stained with 4’,6’-diamidino-2-phenylindole dihy-drochloride (DAPI; 2 ng/ml; Molecular Probes) prior to mounting onto glass slides and then cover slipped with ProLong Gold (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Microbiology 2020Quote: ... we used 15 μL of a mixture of 4’,6-diamidin-2-phenylindole (4 μg mL−1) in SlowFade Gold Antifade Mounting medium (both Thermo Fisher Scientific, Waltham, MA, USA). All solutions and buffers for virus-targeted genomeFISH experiments were prepared with molecular grade water (Carl Roth ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Bioengineering 2023Quote: ... HA-tetrazine was synthesized as described previously using 79 kDa HA with molar equivalents of 1:1:0.25 of HA-repeat units to 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM) (Thermo Fisher Scientific) to tetrazine-amine (Chem-Impex).[16] 1H NMR shifts of pendant tetrazine groups at δ8.5 (2H ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4′-6-diamidino-2-phenylindol) and Myosin Heavy Chain (Myosin 4, eFluor™ 660, Clone: MF20, Affymetrix eBioscience™). All images were taken using a confocal microscope (Zeiss LSM 780 Airyscan ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 1% Penicillin/Streptomycin/L-Glutamate (P/S/G ...
-
bioRxiv - Neuroscience 2021Quote: ... F4/80 (clone BM-8, eFluor450, 4 µg/ml, Invitrogen), CD11c (clone N418 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Pro-inflammatory cytokine (IL-8) and (IL-6) release was determined using the IL-6 and IL-8 ELISA kit (Invitrogen) according to the manufacturer’s instructions (ThermoFisher).
-
bioRxiv - Neuroscience 2021Quote: ... into jaw closer muscles of 5-8 day old mouse pups with 1-2% dilution of Alexa Fluor 488 hydrazide (Life Technologies), under isoflurane anesthesia.
-
bioRxiv - Microbiology 2020Quote: ... Proteins were extracted using lysis buffer (8 M urea, 2 M thiourea, 4% CHAPS, 40mM DTT) supplemented with Halt protease inhibitor complete cocktail (Thermo Fisher) by bead beating (50 Hz for 3 five-minute cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted RNA from sets of 8 adult males (2~4 day old) in triplicate from each RNAi cross using TRIzol (Catalog# 15596-026, Invitrogen, USA), treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Plant Biology 2021Quote: ... protoplasts were resuspended in lysis buffer (45mM magnesium chloride, 30mM sodium citrate, 20mM MOPS, 0.5% triton, 2% 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific), pH 7 ...
-
bioRxiv - Neuroscience 2021Quote: ... fixed larvae were stained with 2.5 ug/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) diluted in PBS to label all cell nuclei ...