Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 23°C ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 minute at 60°C)] on a QuantStudio 5 or QuantStudio 7 qPCR machine (Applied Biosystems). For qPCR assessments ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with 1 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 6 h (42-48 h post stimulation ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... The nucleoids were subsequently stained for 5 min at room temperature with 7-amino-actinomycin D (1 mg/ml 7-AAD in DMSO, Thermo Fisher Scientific) diluted 1:400 in PBS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The qPCR reactions for the data corresponding to Figure 7 and Figure 7 – figure supplement 1 were carried out in 384-well plates on a QuantStudio™ 5 (Applied Biosystems). The thermal cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked for 1h at RT in 5% NBCS (Gibco, #16010-159), antibiotic-antimycotic (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Biochemistry 2023Quote: ... we incubated 5-7 μg of BACMID DNA with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 250 μL of Opti-MEM serum free media for 30 minutes at 23ºC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked for 1h at RT in blocking solution (5% rabbit serum (10510, ThermoFisher) and 1% BSA (A4503 ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... diluted 1:5 in Neurobasal (Gibco) and grown for 5 days in the following medium ...
-
bioRxiv - Immunology 2022Quote: ... + 1% FCS + 5 mM EDTA (Gibco)) and incubated with 5μl TruStain FcX receptor blocking solution (Biolegend ...
-
bioRxiv - Neuroscience 2024Quote: ... TAU-5 (ThermoFisher, AHB0042, 1:2000), and α-tubulin (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml phenol:chloroform 5:1 pH 4.5 (Thermofisher #AM9720) and 0.5 ml glass beads (Sigma #G8772) ...
-
bioRxiv - Neuroscience 2023Quote: ... 47,5% DMEM/F12, 2% B27 w/o Vitamin A, 1% N2 supplement, 1% GlutaMAX, 1% Penicillin/Streptomycin; all from Gibco) supplemented with 10 µM SB-431542 (Torics Bioscience) ...
-
bioRxiv - Neuroscience 2023Quote: ... 47,5% DMEM/F12, 2% B27 w/o Vitamin A, 1% N2 supplement, 1% GlutaMAX, 1% Penicillin/Streptomycin; all from Gibco) supplemented with 10 µM SB-431542 (Tocris Bioscience) ...