Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Propyl 3 trifluoromethyl 1 2 benzisoxazol 6 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... After counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, 1:5,000, #62248, Thermo Scientific), slides were mounted using ProLong Gold Antifade Mountant with DAPI (#P39941 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI,1:20000, Invitrogen D3571) diluted in PBS to visualize cell nuclei (data not shown) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 CAR T cells were co-cultured with γ-irradiated K562-CD19 or K562-CD19-PD-L1 at 1:3 effector:target (E:T) ratio for 7 days and counted with the countess II Automated Cell Counter (ThermoFisher, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... alongside aforementioned activating proteins and CellEvent™ Caspase-3/7 Green Detection Reagent (1:5000, ThermoFisher Scientific, Cat#C10423). Cells were imaged using the IncuCyte ZOOM System (Essen Bioscience ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Sections were counterstained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI) (1 mg/mL, Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... Glucose uptake was measured by the uptake of glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG, Life Technologies). Cell surface and intracellular cytokine stainings of splenocytes and blood lymphocytes were performed as described (42) ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... 1 mM fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Life Technologies) was diluted in Live Cell Imaging Solution (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Cellular glucose uptake was measured by culturing cells in glucose free DMEM for 2 hours before adding 100µM of the fluorescent glucose analogue 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher, N13195). The analogue was incubated with MCF7s for 30 minutes and MSCs for 60 minutes at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24 hrs at 1 hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24hrs at 1-hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2021Quote: ... In vitro derived PCs were stained with CellEvent Caspase 3/7-Green (ThermoFisher), tetrametylrhodamine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with CellEvent Caspase 3/7 Detection Reagent (ThermoFisher Scientific, cat. no. C10423) to a final concentration of 2 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytotoxicity was assessed using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at 1.0 µM and gating on CD45-negative cells ...
-
bioRxiv - Immunology 2020Quote: Macrophages were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS pH 7.4 or pH 6), HA (Sigma-Aldrich, 9067-32-7, 0.5%–1% w/v in Hanks’ Balanced Salt Solution (Gibco, 14025-050) or Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Neuroscience 2020Quote: ... Replicates of hiPSC-derived neurons were harvested at three different timepoints of differentiation (days 1, 3, and 7) with 200 µl Trizol (Invitrogen) per sample and stored at −80 °C until sequencing ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...