Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 7 Phenyl 1 heptanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... on a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the Quantstudio 7 Flex real-time PCR system (Applied Biosystems). Fold change in mRNA levels was calculated using the delta-delta comparative threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were run on a QuantStudio 7 Flex system (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1µg of extracted RNA from passage 7 was DNase (Thermo scientific) treated and converted to cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The viability of cells was verified using 7-AAD (Life Technologies). Samples were acquired with a LSR II (BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... this buffer was supplemented with 7 M of urea (Fisher Scientific). After sonication ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alleles were called using Peak Scanner 2.0 (Applied Biosystems; see (7)) ...
-
bioRxiv - Microbiology 2023Quote: ... on a QuantStudio 12K Flex or a ViiA 7 (ThermoFisher Scientific). Primers (Eurofins ...
-
bioRxiv - Biochemistry 2023Quote: ... AMC (7-amino-4-methylcoumarin) fluorescence reference standard (ThermoFisher Scientific, A191): Prepare a 100 mM stock in DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by 7 days of selection with Blasticidin S HCl (Gibco).
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... and CellTracker Blue (4-chloromethyl- 6.8- difluoro- 7- hydroxycoumarin; CMF2HC; Invitrogen), respectively ...
-
bioRxiv - Cell Biology 2024Quote: Real-time search (RTS)7 was executed in XCalibur (ThermoFisher Scientific). RTS was performed on MS2 scans using a concatenated forward and reverse human reference proteome based on the FASTA file available from Uniprot (updated December 21 ...
-
bioRxiv - Immunology 2024Quote: ... the supernatant was desalted using Zeba 7 kDa spin columns (ThermoFisher) to remove free payload ...
-
bioRxiv - Microbiology 2024Quote: ... and 7 μL of antifade reagent (SlowFadeTM Gold, Invitrogen ref S36937) was added in each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Potassium chloride (7447-40-7-500G) was obtained from Fisher Scientific. Paraformaldehyde (16% ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Immunology 2024Quote: ... with 20 μg/ml of 7-aminoactinomycin D (7AAD, Invitrogen A1310) in perm/wash (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 µL of Herpes solution and 2.5 mL of 100 mM CaCl2), staining with Annexin V PE (BD Pharmagen™, BD Biosciences, CA, US and 1 mM 7-Aminoactiomycin D (Thermo Fisher Scientific) and analysis by Flow Cytometry using a BD LSRFortessa X20.
-
bioRxiv - Bioengineering 2020Quote: ... Scaffolds were washed in PBS at every timepoint (day 1, 4, 7, 14, 28) and placed in a solution of alamarBlue® (Invitrogen, California, USA) in an incubator at 37°C on a shaker ...
-
bioRxiv - Cell Biology 2022Quote: ... and using the Applied Biosystems ViiA 7 Real-Time PCR System and the appropriate primers for Taqman assays (Life Technologies; Supplementary Table 1). The relative gene expression was calculated using the 2-ΔΔCt quantification method after normalization to GAPDH values and expressed as fold of levels found in undifferentiated hPSCs cells for cultured cell or in WT mice group for liver analysis.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... at ~10 mg ml-1 concentration and blotted for 5-7 s followed by plunge-freezing into liquid ethane using a Vitrobot MarkIV (Thermo Fisher Scientific, USA) operating at 100 % humidity ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of RNA were reverse transcribed and amplified using TaqMan™ RNA-to-C T ™ 1-Step Kit kit on the ViiA 7 Real-Time PCR System (Applied Biosystems). TaqMan gene expression assay probes (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we added all four nucleotides at a final concentration of 1 µM (Biotin-7-dATP, Jena Biosciences, and dC-Atto647N or dU-Atto488, Jena Biosciences with respective pair of unmodified nucleotides, Thermo Scientific): [Biotin-7-dATP ...
-
bioRxiv - Immunology 2024Quote: ... then collected and plated 10:1 with allogeneic DC-10s in 24-well plates at a concentration of 7 × 105 to 1 × 106 T cells/mL in T cell media with 10 U/mL rhIL-10 (Gibco, Thermo Fisher Scientific). For CRISPRa experiments ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...