Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 7 Oxabicyclo 4.1.0 hept 3 ene 3 carboxylicacid methylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24 hrs at 1 hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24hrs at 1-hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2021Quote: ... In vitro derived PCs were stained with CellEvent Caspase 3/7-Green (ThermoFisher), tetrametylrhodamine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with CellEvent Caspase 3/7 Detection Reagent (ThermoFisher Scientific, cat. no. C10423) to a final concentration of 2 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytotoxicity was assessed using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at 1.0 µM and gating on CD45-negative cells ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 µM Caspase-3/7 Green detection reagent (C10423, Invitrogen) along with the specified compounds ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Cell Biology 2019Quote: ... The pellet was resuspended 3 times using 7 mL Wheaton Dounce tissue grinder (Fisher Scientific) and centrifuged at 12,000 rpm at 4°C for 30 minutes (Sorvall SS-34 centrifuge rotor) ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Biochemistry 2020Quote: ... The fluorogenic probe 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (abbr. CPM, ThermoFisher, Cat# D346) in 100% DMSO was then added to both quench the enzymatic reaction and react with CoASH to yield the fluorescent CPM-SCoA complex for fluorescence quantification 27 ...
-
bioRxiv - Genetics 2020Quote: ... 25 μL of media containing STS and CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at final treatment concentrations of 1 μM and 2.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... The electrodes were labelled with DiIC18(7) (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindotricarbocyanine Iodide) (DiR) (Invitrogen) to enable post-mortem reconstruction of the electrode tracks in histological sections.
-
bioRxiv - Immunology 2022Quote: ... Alexa Fluor 488 and caspase-3/7 activity detection dyes were purchased from Thermo Fisher, and Viobility™ 405/452 Fixable Dye from Miltenyi Biotec.
-
bioRxiv - Microbiology 2023Quote: ... Apoptosis assays were perfomed using CellEvent Caspase 3/7 Green Detection Reagent (Thermo Fisher Scientific) and Live/Dead eFluor 660 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were stained with CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Cancer Biology 2019Quote: ... T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher, C10423) in 96 well plates ...
-
bioRxiv - Microbiology 2023Quote: ... mass spectrometer and TOF/TOF Series Explorer Software v.4.1.0 (Applied Biosystems). External calibration was performed using CalMix5 (Protea) ...
-
bioRxiv - Cancer Biology 2021Quote: ... U251 cells were treated with 4 uM CellEvent Caspase-3/7 green detection reagent (Molecular probes) prior to imaging ...
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activity was assessed using CellEvent(tm) Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) following manufactures protocol ...
-
bioRxiv - Genomics 2021Quote: ... Laser Capture Microdissection (LCM; N=3; 7 µM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522), multiplex or regular immunohistochemistry (N≥3 4 µM glass slide ...
-
bioRxiv - Genetics 2020Quote: ... Colonies were passaged every 4 – 7 days using 3 – 5min incubation with 0.5mM UltraPure EDTA (Invitrogen) as required.
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... follicles were incubated with 500 nM CellEvent™ Caspase-3/7 Green Detection Reagent (C10427, Invitrogen). Oocytes were stained with 150 nM Sir-Tubulin (CY-SC002 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged every 3-7 days as single cells using TrypLE™ Select CTS™ (Gibco). The ROCK inhibitor Y27632 (Fujifilm ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Taqman® assays (Supplementary table 3) and QuantStudio™ 7 Flex Real Time PCR system (ThermoFisher, USA), and relative expression levels determined using QuantStudio™ 7 Real Time PCR software.
-
bioRxiv - Neuroscience 2019Quote: ... unc-7 rescue plasmids were made using the Multisite Gateway® 3-Fragment Vector Construction Kit (Invitrogen). A 1078bp mec-4 promoter fragment (as previously used ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...