Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7 HYDROXY 5 METHYL 1 3 4 TRIAZAINDOLIZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Vero-E6 cells and Calu-3 were treated with 5 μg/ml or 1 μg/ml puromycin (Gibco), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... we slowly injected 0.5-1 μL rAAV (about 1∼3×109 genome copy (GC)) mixed with Chicago Sky Blue dye (0.1%, Fisher Scientific, Cat # AAA1424214) into the oviduct ampulla using a glass micropipette with tip diameter of ∼10-30 μm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lungs were dissected and placed in ice cold FACS buffer (1% BSA, 3% FBS, 96% Ca2+ and Mg2+ free PBS) with 1 μg/ml Actinomycin D (ThermoFisher BP606-5). After isolation ...
-
bioRxiv - Cell Biology 2023Quote: ... were seeded on the top of the membrane and cultured for 3 days in DMEM/F12 (1/1) supplemented with 5 % fetal bovine serum (Fetal Clone II; Hyclone, Thermo Scientific, France), 0.2 ng/ml EGF (Gibco) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and passaged every 3-4 days using Gibco TrypLE Express (ThermoFisher). For imaging ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Genetics 2020Quote: ... in a proportion of 4:3:2 using Lipofectamine 2000 (ThermoFisher). HEK293T cells were maintained in DMEM complete medium (DMEM [Gibco] supplemented with 10% of FBS and 100 UI of Penicillin/Streptomycin) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Immunology 2023Quote: ... 20 ng ml-1 GM-CSF (Biozym) or X38-Ag8 supernatant (1%) and from day 5 on additionally with 10 ng ml-1 IL-4 (Life technologies). At day 7 ...
-
bioRxiv - Genomics 2023Quote: ... plugs were washed 4 times in 1×Wash Buffer (BNG) and 5 times in 1× TE Buffer (ThermoFisher Scientific, Waltham, MA). Then ...
-
bioRxiv - Microbiology 2022Quote: ... incubated for 10 min in the dark at room temperature with FM 4-64FX (3 μg ml-1) (ThermoFisher). Cells were applied to a 5% agarose pad containing M9 minimal media with glucose (0.4%) ...
-
bioRxiv - Genetics 2022Quote: Immunoprecipitations were performed using 1 μg of Anti-Trimethyl-Histone-3-Lys-4 (-Thermo Fisher Scientific; catalog# PA5-17420) overnight at 4 ◦ C ...
-
bioRxiv - Neuroscience 2022Quote: 100 to 150 3-dpf zebrafish larvae were bathed in Yo-Pro-1 (4 µM, 30 min) (Invitrogen, Y3603), then washed 3 times in blue water to label lateral line hair cells ...
-
bioRxiv - Immunology 2023Quote: ... and packaging vector psPAX2 were mixed in a 4:3:1 ratio in OPTI-MEM (Thermo Fisher Scientific, 31985070) and PEI (Polysciences ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.1% Triton X–100 and 400 μM Maleimidobenzoyl–N–hydroxy succinimide ester (ThermoFisher Scientific, 22311), washed two times with 1x Phosphate–buffered saline (PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) or FxCycle™ PI/RNase Staining Solution (Thermofisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-aminoactinomycin D (7-AAD, Thermo Fisher, A 1310) was added 1:50 as a cell death marker.
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were split every 5-7 days by incubation with 0.5 μM EDTA (Thermo Fisher Scientific) for 4 min at room temperature and clumps were dissociated into small clumps by pipetting ...
-
bioRxiv - Biochemistry 2023Quote: ... 7 mM NaOH) followed by an incubation of 5 hrs with Dynabeads Protein G (Invitrogen, 10004D). Beads were then washed with Wash Buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were grown at 37 °C under 5% of CO2 in DMEM Glutamax (Gibco) with 10% bovine fetal serum ...
-
bioRxiv - Neuroscience 2023Quote: ... 15-20 pooled day 30 neurospheres and 5-7 pooled day 60 organoids using TRIzol (Invitrogen; Thermo Fisher Scientific Inc. ...
-
bioRxiv - Pathology 2022Quote: Cell viability of the MRC-5 cells cultured on LdECM and Ru-LdECM hydrogels was assessed after 1 and 7 days using Calcein AM (Thermo Scientific, Breda, the Netherlands) to stain live cells and propidium iodide (PI ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... A 1 ml aliquot was treated with 2 μM tetramethylrhodamine methyl ester perchlorate (TMRE) (Molecular Probes, USA) and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA plus PIC) with 20 mM thiol-reactive methyl-methane thiosulfonate (MMTS, Thermo Fisher Scientific) to block free cysteine residues ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Bioengineering 2020Quote: ... methyl ester (TMRM) (0.1µM in hepatocyte medium, Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Bioengineering 2022Quote: ... mitochondrial membrane potential (tetramethylrhodamine methyl ester, TMRM; ThermoFisher Scientific) and mitochondrial superoxide (MitoSOX Red ...