Labshake search
Citations for Thermo Fisher :
551 - 600 of 2538 citations for 7 Chloromethyl Drospirenone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... on a QuantStudio 12K Flex or a ViiA 7 (ThermoFisher Scientific). Primers (Eurofins ...
-
bioRxiv - Microbiology 2023Quote: ... this buffer was supplemented with 7 M of urea (Fisher Scientific). After sonication ...
-
bioRxiv - Cancer Biology 2023Quote: Huh-7 cells were transiently transfected with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... cells were harvested at day 7 using trypsin-EDTA (Fisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 1µg of extracted RNA from passage 7 was DNase (Thermo scientific) treated and converted to cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alleles were called using Peak Scanner 2.0 (Applied Biosystems; see (7)) ...
-
bioRxiv - Immunology 2024Quote: ... the supernatant was desalted using Zeba 7 kDa spin columns (ThermoFisher) to remove free payload ...
-
bioRxiv - Microbiology 2024Quote: ... and 7 μL of antifade reagent (SlowFadeTM Gold, Invitrogen ref S36937) was added in each well ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... with 20 μg/ml of 7-aminoactinomycin D (7AAD, Invitrogen A1310) in perm/wash (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Pathology 2024Quote: ... on a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or LipofectamineTM 2000 (Thermo Fisher, COS-7 and SH-SY5Y cells). Imaging was performed 24 h after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Cell Biology 2024Quote: ... Potassium chloride (7447-40-7-500G) was obtained from Fisher Scientific. Paraformaldehyde (16% ...
-
bioRxiv - Cell Biology 2024Quote: Real-time search (RTS)7 was executed in XCalibur (ThermoFisher Scientific). RTS was performed on MS2 scans using a concatenated forward and reverse human reference proteome based on the FASTA file available from Uniprot (updated December 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... AlexaFluor 568 goat anti mouse (Invitrogen, A11004, 7 RRID:AB_2534072, 1:2000), AlexaFluor 568 anti rabbit (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...