Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 7 Chloro 5 methyl 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: To assess GUS expression driven by the maize ubiquitin promoter in transgenic barley transformed with the pBRACT214m-GUS construct we collected different tissues and stained these with 1mg/ml of X-gluc (5-bromo-4-chloro-3-indolyl-B-D-glucuronic acid, Thermo Scientific, USA) in X-gluc buffer (100mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7H11 plates contained 50 μg/mL hygromycin and 50 μM 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Thermo Scientific). Unless specified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Microbiology 2020Quote: ... for 1h at 37°C and 0.05% trypsin (Invitrogen, 25300054) for 15min at 37°C and re-plated at a density of 400 cells/μl of Matrigel (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Biochemistry 2020Quote: ... in pyridine (Thermo Fisher Scientific, 25104) at 60 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... and 4-(dimethylamino)pyridine (Fisher Scientific) (3:1 to HA-TBA repeat unit ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Immunology 2021Quote: C-LP cells pooled from 5-7 mice were sorted into TriZol® (Thermo Fisher) and cDNA was generated by using QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells were grown on glass coverslips and incubated for 1h (37°C, 5% CO2) with EU from the Click-iT RNA Alexa Fluor 594 imaging kit (C10330, Invitrogen). Cells were fixed with 3,7% formaldehyde in PBS 1× for 15min at room temperature and permeabilized with 0.5% Triton X-100 in PBS 1× for 15min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... program #3 for 7 min (ThermoFisher). The membrane was saturated by incubation in PBS (without EDTA ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... and then Pyridine (0.02 mol; Fisher Scientific) was injected to the mixture ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 minute at 60°C)] on a QuantStudio 5 or QuantStudio 7 qPCR machine (Applied Biosystems). For qPCR assessments ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were grown at 37 °C under 5% of CO2 in DMEM Glutamax (Gibco) with 10% bovine fetal serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Cancer Biology 2021Quote: ... freshly isolated MNCs were washed and re-suspended in PBS and stained for 10 min at 37°C with 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) at a concentration of 5 µM (Thermo Fisher Scientific, Waltham, MA, USA). H2DCFDA is a non- fluorescent dye which is cleaved inside cells to 2’,7’-dichlorofluorescein (H2DCF) ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... CellEvent Caspase-3/7 Detection Reagent (Invitrogen) and Hoescht were added to the media at concentrations listed in S4 Table and incubated for 30min at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... CellEvent Caspase-3/7 (Life Technologies C10723), Fis1 polyclonal antibody (Proteintech 109561-AP) ...
-
bioRxiv - Cell Biology 2023Quote: ... Caspase 3/7 (Thermo Fisher Scientific, #C10423) activation and propidium iodide (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and caspase 3/7 (Thermo Fisher Scientific) were prepared following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... live zebrafish larvae (7 dpf) were incubated at 28°C in 2 mM EdU (Invitrogen, #C10340) in E3 medium for 2 h followed by a further incubation in fresh E3 medium for 1 h ...