Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (C10723) and PrestoBlue™ Cell Viability Reagent (A13261) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... the COS-7 cells were transfected with plasmids encoding tubulin (3×mEmerald-ensconsin) and ER (mCherry-KDEL) by using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol17 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... the media was replaced with DMEM + 10% FBS + CellEvent Caspase-3/7 Detection Reagent (Green) according to the manufacturers recommendations (Invitrogen). The plate was then imaged every 15 minutes using phase and GFP channels in the ZEISS Celldiscoverer 7 Automated Live Cell Imager set to 42°C at 5% CO2 and 20% O2 ...
-
bioRxiv - Cell Biology 2023Quote: ... After fixing for 1h at 4°C in 4% PFA (prepared in PBS; Thermo Fisher Scientific, catalog 043368.9M), embryos were rinsed with PBS and then cryoprotected in 30% sucrose in 0.1M phosphate buffer overnight at 4°C ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged every 2-3 days by washing with HBSS (Gibco, cat#14170), trypsinizing using 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MMT) was obtained from Thermo Fisher. Crystal violet was purchased from VWR ...
-
bioRxiv - Bioengineering 2020Quote: Nbs were diluted in a 2- or 3-fold series in Opti-MEM (Thermofisher). Each Nb dilution (110 μl ...
-
bioRxiv - Physiology 2021Quote: ... cells were fed every 2-3 days with DMEM + 10% FBS (Thermo fisher Scientific) until differentiation was complete at day 10.
-
bioRxiv - Immunology 2022Quote: ... The band are visualized with gel electrophoresis using 2-3% agarose (#16500500, Thermo Fisher) gel with SYBR Safe dye (#S33102 ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibody (2-3% serum, 0.4% PBST, 1:500 Invitrogen A11035, 1:500 DAPI) was applied and incubated for one hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2-3 sections were mounted on each Superfrost Plus slide (Thermo Fisher Scientific). All sections were air-dried at −20 ° C for 1 hour and afterwards stored at −80 ° C.
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... and 2 µl of DNA using QuantStudioTM 3 real-time PCR system (ThermoFisher Scientific). For the amplification of GLS promoter region upstream of the repeat ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Plant Biology 2022Quote: ... CMAC (7-amino-4-chloromethylcoumarin, Cat. #C2110, Invitrogen) was used at a final concentration of 10μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc, Waltham, MA). Viral supernatants were collected 48 hours post-transfection and filtered through a 0.45 μm Nalgene syringe filter SFCA (Whatman ...
-
bioRxiv - Cancer Biology 2021Quote: ... the slides were washed 3 times with PBS and incubated for 1h at room temperature with goat anti-rabbit AlexaFluor-568 (ThermoFisher, Invitrogen A-1101, 5ug/ml working solution). After washes with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...
-
bioRxiv - Cell Biology 2021Quote: ... then stained for one minute with 30 ng/mL 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) in 1x PHEM ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...