Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
A nepenthesin insert allosterically controls catalysis in the malaria parasite protease plasmepsin VbioRxiv - Microbiology 2022Quote: ... Lysates were then incubated for one hour at 4°C with Dynabeads-Protein A or Dynabeads-Protein G (ThermoFisher) that had been bound to anti-GFP (clone 3E6 ...
-
Drosophila immune priming to Enterococcus faecalis relies on immune tolerance rather than resistancebioRxiv - Immunology 2022Quote: ... Samples were centrifuged at 10,000 rcf at 4°C for one minute directly into a 1.5mL microcentrifuge tube containing 350uL TriZol (Life Technologies) (schematic in Supplementary Figure 4A) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse HMB45 (1:20; 4°C overnight; Life Technologies, 081050). Afterwards ...
-
bioRxiv - Neuroscience 2023Quote: ... and processed at 4°C with NeuroTrace (1:500, Invitrogen) in PBS containing 0.3% Triton-X ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Physiology 2020Quote: ... and incubated in cell* dishes at 37° C for 4 – 7 hours before adding cell culture medium (RPMI 1640, -glucose +glutamine, Gibco), supplemented with penstrep (10,000 U/ml penicillin / 10,000 μg/ml streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and visualized using FITC 488 nm filter ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... plates were treated with 2 μM of the CellEvent™Caspase-3/7 green detection reagent (Life Technologies, UK) for 60 minutes at 37 °C in the dark ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C (Nunc MaxiSorp flat bottom ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Immunology 2021Quote: ... 1 × 105 activated NKT cells were incubated with 1 mM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen) in RPMI complete media for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated with goat anti-rabbit IgG Alexa 488 secondary antibody (1:500 for 2 h at 4°C; Invitrogen) in solution with PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... The filtrate was then incubated for 1 h rotating at 4 °C with 2 mL Ni-NTA resin (Thermo Fisher) per 1.5 L of expression culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was incubated o/n at with rotation at 4°C with 2 µg IP antibody and for 1 h with Dynabeads Protein G (Invitrogen). Alternatively ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were centrifuged at 500 ×g for 5 minutes at 4°C and washed and resuspended with ice-cold FACS Buffer (2 or 10% FBS in 1× HBSS (Gibco) or 1X PBS) ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were incubated with secondary antibody for 3 nights at 4°C with secondary antibodies at 1:500: goat anti-rabbit Alexa Fluor 488 (ThermoFisher #A-11008) and goat anti-mouse Alexa Fluor 647 (ThermoFisher #A-21236) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with ice-cold PBS-BSA before secondary labeling for 1 h at 4°C in 3 mL1:200 PE-conjugated streptavidin (Thermo Fisher S866) to label for bound ACE2 ...
-
bioRxiv - Microbiology 2020Quote: ... Pre-cleared lysates were further incubated at 4°C overnight with the indicated antibodies (1 to 3 μl) and protein A agarose or protein G Dynabeads (Thermo Fisher Scientific). Immunoprecipitates were washed three times with RIPA buffer (LSB ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies were incubated on slides in a the dark for 3 hours at room temperature or overnight at 4°C: GαM 488 (Invitrogen A21121, 1:1000), GαRb 546 (Invitrogen A11010 ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with 2 µg/ml CD40 protein (ThermoFisher, A42565) in fresh PBS ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 h at 4°C and processed through Zeba spin desalting columns (ThermoFisher) to remove excess unbound biotin ...
-
bioRxiv - Immunology 2024Quote: ... for 2 h at 4°C and processed through Zeba spin desalting columns (ThermoFisher) to remove excess unbound biotin.
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... The nucleoids were subsequently stained for 5 min at room temperature with 7-amino-actinomycin D (1 mg/ml 7-AAD in DMSO, Thermo Fisher Scientific) diluted 1:400 in PBS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The qPCR reactions for the data corresponding to Figure 7 and Figure 7 – figure supplement 1 were carried out in 384-well plates on a QuantStudio™ 5 (Applied Biosystems). The thermal cycling conditions were as follows ...
-
bioRxiv - Genomics 2023Quote: ... at 4°C for 3 hours followed by addition of 10 ml Protein A Dynabeads (Invitrogen) for 20 min to capture the antibody-protein complexes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The grids were washed by dipping 2 times in PBS (37°C) before 3 μL of 1 μm Dynabeads (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Bioengineering 2019Quote: ... and one of the pLKO.1 shRNA plasmids using 5:1 lipofectamine 2000 (Thermo Fisher Scientific):DNA (v/w ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: ... followed by 40 cycles of 95°C for 15 s and 60°C for 1 min (Applied Biosystems QuantStudio 7 Flex). Primers used for qPCR reactions are listed in Supplementary Table S5 ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR program comprised an initial denaturation for 30 s at 95 °C and amplification by 40 cycles of 15 s at 95 °C and 1 min at 60 °C and was ran in an ABI QuantStudio 7 Real Time PCR machine (Applied Biosystems). Expression values of DIN6 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...