Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 7 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Monocytes were incubated for 7 days with RPMI-1640 (Gibco) supplemented with 100 ng/ml MCS-F (#300-25-100 ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Physiology 2021Quote: ... in the ViiA 7 Real-Team PCR System (Thermo Fisher) with the following times ...
-
bioRxiv - Physiology 2020Quote: ... 7-AAD or fixable viability dye eFluor780 (Thermo Fisher Scientific) served as a live-dead stain ...
-
bioRxiv - Physiology 2021Quote: ... in a ViiA 7 Real-Time PCR System (Applied Biosystems) using ViiA 7 Software (Applied Biosystems).
-
bioRxiv - Genomics 2021Quote: ... (7) we relaxed the filtering criterion used by Thermo Fisher Scientific and selected the best markers in the remaining set ...
-
bioRxiv - Bioengineering 2021Quote: ... using the ViiA™7 RT-PCR System (Applied BioSystems). Quantification was performed by calculating the ΔCt value using GAPDH as a reference and results are shown as mRNA expression levels (2-ΔCt ...
-
bioRxiv - Genetics 2021Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). Four technical replicates were pipetted on a 384-well plate using the JANUS automated workstation (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences are listed below.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 7% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mmol/L Glutamax (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle.
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 and COS-7 cells and Lipofectamine 2000 (Thermo Fisher) reagent for NIH3T3 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... on microscopy plates (Cat. #12-544-7, Thermo Fisher Scientific), and sealed with nail polish (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... on ViiA™ 7 Real-Time PCR System (Applied Biosystems) using Platinum™ SYBR™ Green qPCR SuperMix-UDG w/ROX (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). 18S rRNA served as the internal control ...
-
bioRxiv - Cell Biology 2022Quote: ... on QuantStudio 7 Flex Real time PCR system (Applied Biosystems). Reactions were performed in triplicate and RNA expression was normalised to 36b4 ...
-
bioRxiv - Cell Biology 2022Quote: ... using a ViiA-7 Real-Time PCR system (Applied Biosystems). Fold change in expression was calculated by the ΔΔCt method using actin as a control ...
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...
-
bioRxiv - Pathology 2022Quote: ... with QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The following primers were used in qPCR experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples wererun on a QuantStudio 7 Flex system (Applied Biosystems) using manufacturer ‘s recommended cycling conditions ...
-
bioRxiv - Physiology 2023Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Four technical replicates were averaged for each sample per primer reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 7% (v/v) fetal bovine serum (Thermo Scientific) and 100 U/ml penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... A ViiA 7 real-time PCR system (Thermo Fisher Scientific) was used to determine each reaction cycle threshold ...
-
bioRxiv - Cancer Biology 2023Quote: ... 7 μg/ml polybrene Polybrene (Thermo Fisher Scientific GmbH 11360039) was added to each viral sample ...
-
bioRxiv - Microbiology 2023Quote: ... in QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher). The relative change of viral RNA between the compound-treated infection samples and the control infection samples was calculated using the ΔCt values ...
-
bioRxiv - Microbiology 2023Quote: ... A ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) was used to amplify and quantify cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... using a ViiA 7 Real-Time PCR system (Thermo Fisher). Ct values from n=6 (three measurements from two independent experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a ViiA 7 Real-Time PCR system (Applied Biosystems) along with primers ...
-
bioRxiv - Plant Biology 2023Quote: ... according to manufacturer’s instructions on a ViiA 7 system (ThermoFisher). Primers are listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) was used for Real-time PCR reactions with the Maxima SYBR Green/ROX qPCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen, # D399), was used to estimate Reactive Oxygen Species (ROS ...
-
bioRxiv - Immunology 2023Quote: ... Zeba Spin Desalting Columns (7 K MWCO, 2ml. Thermo Fisher) were then used to separate crosslinked proteins from excess crosslinker and reaction byproducts ...
-
bioRxiv - Cell Biology 2023Quote: ... 7-AAD viability staining solution (Thermo Fisher Scientific, 00-6993) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... The QuantStudio 7 Flex real-time PCR system (Applied Biosystems) with the following program was employed for qPCR analysis ...
-
bioRxiv - Biophysics 2022Quote: ... MCF-7 cells were cultured in MEM (Thermo fisher, 11095072) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher). Relative gene expression was determined using the change-in-threshold (2-DDCT ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellEvent Caspase-3/7 Green Flow Cytometry Kit (Thermo Fisher) was used to measure fraction of apoptotic cells by flow cytometry (BD LSR Fortessa with HTS sampler) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7% glycerol) containing protease and phosphatase inhibitors (Thermo Scientific; 1861281). Cells were scraped into a 1.5-mL tube ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher) in 384-well plates (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen CellEvent Caspase-3/7 green detection reagent (C10423, ThermoFisher) was used as stated in manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems), using the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher) in 384 well plates (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... on the ViiA 7 Real-Time PCR instrument (Applied Biosystems). The following primers were used for Gli1 (Fwd GAG GTT GGG ATG AAG AAG CA ...
-
bioRxiv - Biochemistry 2023Quote: ... Chromatograms were analyzed using Chromeleon 7 software (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... Data were processed using ViiA™ 7 Software (Applied Biosystems) and analyzed with the 2(−ΔCT ...
-
bioRxiv - Physiology 2023Quote: ... with the ViiA 7 Real-Time PCR System (Applied Biosystems). Relative mRNA levels were normalized to GAPDH ...
-
bioRxiv - Plant Biology 2024Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle ...