Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 7 Bromo 2 3 dihydro isoindol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ISH and dFISH were performed as previously described (3, 7, 62) with addition of T1 RNAse treatment (2 u/µl, Thermo Fisher Scientific, Waltham, MA, USA) after probe washing in embryos older than 4 dpf to reduce background staining ...
-
bioRxiv - Bioengineering 2021Quote: Human lung fibroblasts (hTERT T1015, abmgood) were used between passages 7-12 and culture medium was changed every 2-3 days (Gibco Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 v/v% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with mouse mAb SARS-CoV-2 nucleocapsid antibody (SinoBiological, 1:100) and rabbit Claudin 7 polyclonal antibody (ThermoFisher, 1:200) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The iPSCs were then cultured for 7 days in Neurobasal/DMEM-F12 medium (1:1 v/v) containing 2% B27 (Gibco, 17054–044), 1% N2 (Gibco ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Cell cycle was examined by flow cytometry following 5′-bromo-2′-deoxyuridine (BrdU) labeling (BrdU: Sigma-Aldrich, MB5002; BrdU antibody: Invitrogen, B35129) and propidium iodide (PI ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N and D35C4-20-1.5N) ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by the iBlot 2 transfer system (Invitrogen, 20 V for 7 min). The membranes were blocked with 3% nonfat milk or ECL PrimeTM blocking agent (Cytiva ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2021Quote: ... we re-suspended cells in PBS/ 0.2% human serum containing 2 µg/mL 7-aminoactinomycin D (7-AAD) (Invitrogen, Cat# A1310). We carried out isotopic controls with irrelevant mouse IgG1-APC ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNAs from 7-d-old seedlings grown on 1/2 MS with or without 1 μM ABA were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) or Universal Plant Total RNA Extraction Kits (Spin-column)-I (BioTeke ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2024Quote: ... Sept-7 1/800 (Thermo scientific, PA5-54755), GAPDH 1/5000 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 Culture One (ThermoFisher #A33202-01). Depending on the length of the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocking buffer was replaced after one hour with 7 µg/mL mouse anti-occludin antibody (cat# 33-1500, Invitrogen) in PBS with 5% goat serum ...
-
bioRxiv - Neuroscience 2021Quote: Astrocytes at 3 DIV or at 7-8 DIV after lentivirus infection were loaded with 1 μg/ml Fura-2-AM (#F1221, ThermoFisher) in astrocyte culture medium for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... organoids developed within 7 - 21 days after initial seeding and were first passaged (1:2) by dissociation using TrypLE Express Enzyme (ThermoFisher) and resuspension in OcellO primary organoid medium ...