Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7 Benzyl 4 chloro 5 6 7 8 tetrahydropyrido 3 4 d pyrimidin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... at 6-7 days in vitro (DIV) or Lipofectamine 2000 (Thermofisher) 24/72 hours before the experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... iPSCs were passaged every 6-7 days with Versene (Life Technologies) at a 1:12 ratio ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2023Quote: ... 5 μl of 7-AAD (Invitrogen, 00-6993-50) was included for dead cell exclusion.
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... After a clarifying spin for 15 min at 14,000 ×g and 4°C 2 μl (MICOS complex) or 7 μl (all other mitochondrial protein complexes) G-250 Sample Additive (Invitrogen, Waltham, Massachusetts, USA) containing 40% glycerol were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... cells were stained with CellEvent Caspase-3/7 Green (Invitrogen). The cytotoxicity was assessed by flow cytometry as the percentage of Caspase 3/7+ cells in the target cell population ...
-
bioRxiv - Immunology 2022Quote: ... stained for apoptosis with CellEvent Caspase-3/7 (Thermo Fisher), incubated for additional 30 min ...
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellEvent Caspase-3/7 Green Flow Cytometry Kit (Thermo Fisher) was used to measure fraction of apoptotic cells by flow cytometry (BD LSR Fortessa with HTS sampler) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen CellEvent Caspase-3/7 green detection reagent (C10423, ThermoFisher) was used as stated in manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Caspase-3/7 assay kit was used (Invitrogen, C10427). Each tube was brought to a volume of 1 ml staining buffer and 1 μl of CellEvent Caspase-3/7 reagent was added ...
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (ThermoFisher) transferred to nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2019Quote: ... in addition to 7-Aminoactinomycin D (7AAD; ThermoFisher Scientific, Ref#A1310) for viability to monitor donor chimerism within the different lineages and the appearance of leukemic blasts characterized by a distinct scatter and lower GR1 and CD11b expression within the myeloid compartment ...
-
bioRxiv - Immunology 2024Quote: ... with 20 μg/ml of 7-aminoactinomycin D (7AAD, Invitrogen A1310) in perm/wash (BD Biosciences) ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.
-
bioRxiv - Immunology 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, CA, USA) was used to stain cell nuclei ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed with FACS buffer and incubated with the live-dead marker 7-aminoactinomycin D (7-AAD; Thermo Fisher Scientific) for 10 min at 4 °C in the dark ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of 7-amino-actinomycin D (7AAD, 50 μg/ml working solution in PBS, Thermo Fisher Scientific) was added to the stained cells 5–10 min before measurement.
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Microbiology 2022Quote: ... Proliferating organoids were grown for 4–7 days and dissociated using TrypLE Express Enzyme (Thermo Fisher Scientific) for 10–20 minutes in a 37°C water bath ...