Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 7 BROMO 3 OXO 3 4 DIHYDROQUINOXALINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: Human lung fibroblasts (hTERT T1015, abmgood) were used between passages 7-12 and culture medium was changed every 2-3 days (Gibco Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 v/v% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Developmental Biology 2020Quote: ... ES cells were passaged every 3–4 days using Accutase (Thermo Fisher) and used to passage 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... blotted for 3–4 s in a Vitrobot Mark IV (Thermo Fisher) at 15 °C and 100% humidity ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were grown for 3-4 days in Neurobasal medium (Thermo Fisher) supplemented with 2% FBS (HyClone) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... samples were diluted 3:1 in 4× NuPAGE LDS sample buffer (Invitrogen) supplemented with 10% beta-mercaptoethanol (v/v) ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Stained cells were cytospun (Thermo Scientific Cytospin 4 1000rpm for 3 minutes) onto 1.5 thickness coverslips and mounted with ProLongTM Gold mounting medium (Molecular Probes #P36934 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 4:3:1 ratio into 293FT cells (Thermo Fisher Scientific, #R70007) with Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... iPSC-neurons were incubated with 3 µM Fluo-4 (Life Technologies #F14201) at 37°C for 20 min and imaged directly following washout on an LSM Zeiss 880 inverted confocal microscope using a 63×oil 1.4 numerical aperture objective and a 488-nm argon ion laser ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were passaged every 3 to 4 days using Accutase™ (Gibco) for up to 10 passages.
-
bioRxiv - Cancer Biology 2023Quote: ... in a 4:3:1 mass ratio with Lipofectamine 2000 (Invitrogen # 11668019) in a 2:1 ratio of Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Invitrogen) and DiD (1,1’- Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt; Invitrogen) crystals were inserted under a stereo fluorescence microscope (MZ10 F ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged enzymatically every 3-4 days using 0.25% Trypsin (Gibco) diluted 1:3 in 1X PBS (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µM 3-isobutyl-1-methylxanthine (Thermo Scientific, Cat # 28822-58-4), 1 µM dexamethasone (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary neurospheres grown for 3 days (3-4 million cells) were harvested and crosslinked with 0.5% formaldehyde (Thermo Fisher, cat. no. 28908) in 0.1 M DPBS for 5 min at RT with soft agitation ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Physiology 2020Quote: ... muscles were stained for 3 minutes with 10μM 4-(4-diethylaminostyrl)-N-methylpyridinium iodide (4-Di-2ASP, Molecular Probes) to allow imaging muscle with an upright epifluorescence microscope (Leica DMR ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were first loaded for 3 min onto the Acclaim PepMap 100 C18 trap column (75 µm x 2 cm, 3 µm material, Thermo Scientific) with 5 µL min-1 of 3.2% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: HeLa cell pellets (∼2×107) or MCF7 cell pellets (∼4×107) were lysed with 3 mL Mammalian Protein Extraction Reagent (Thermo Scientific), supplemented with 2X HALT protease inhibitor (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... 2 and 4 h post dosing on day 3 and collected on ice in microcentrifuge tubes containing K2-EDTA (Fisher Scientific). Within 30 min after collection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3-4 mg total protein and 2 ug of KIF1C antibody or 10 ug mCherry antibody (Invitrogen mCherry Monoclonal Antibody (16D7)) were used ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
The effects of caloric restriction on adipose tissue and metabolic health are sex- and age-dependentbioRxiv - Physiology 2023Quote: ... Tissues in formalin were fixed at 4°C for 2-3 days before being washed and stored in DPBS (Life Technologies). Tissues on dry ice were stored at −80°C prior to downstream analysis.
-
bioRxiv - Developmental Biology 2022Quote: ... Table 2) incubated for 3 overnights at 4 °C in blocking buffer with Alexa-dye conjugated secondary antibodies (1:500, Molecular Probes) incubated for 1 overnight at 4 °C in blocking buffer ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... and G3BP1 were labeled on their N-termini with AF488 (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Storage buffer was exchanged to Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Immunology 2021Quote: ... and then stained with cell impermeable SYTOX green nucleic acid stain (3 µM, ThermoFisher Scientific) for 30 min ...