Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 7 BENZYL 1 4 DITHIA 7 AZA SPIRO 4.4 NONANE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: Total RNA from around 20 whole flies of both sexes at 4-7 days old was extracted using a PureLink RNA Mini Kit (Cat# 12183020, ThermoFisher Scientific, USA). Reverse transcription (RT ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins were separated by sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) in either homemade 7% or 4-12% gradient Bis-Tris polyacrylamide gel (Thermo Fisher Scientific) using 3-(N-morpholino)propanesulfonic acid (MOPS ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Cell Biology 2024Quote: ... The flow-through was then dried in a speed-vac and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...
-
bioRxiv - Cell Biology 2020Quote: ... COS-7 cells were grown on thin coverslips (Thermo Fisher Sci. 12541A) in 6 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR reaction was run in ViiA 7 Real-Time PCR System (ThermoFisher) with standard program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95 °C with a rate of 0.015 °C per second ...
-
bioRxiv - Immunology 2022Quote: ... on a Quant-Studio 7 Flex Real-Time PCR System (Applied Biosystems). Transcript abundances were normalized to 18S rRNA abundance ...
-
bioRxiv - Genomics 2022Quote: ... and HeLa S3 and MCF-7 RNAs were purchased from Thermo Fisher. RNAs from matched frozen healthy/tumor tissues of breast cancer patients were purchased from Origene (500 ng ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... with an Applied Biosystems ViiA 7 Real-Time PCR System (Life Technologies). Quantitation of the results was performed by the comparative Ct (2-[delta][delta]Ct ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using a ViiA7 instrument (ViiATM 7 real-time PCR system, Life Technologies). The sequences of primer for human Naaa are ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the ViiA™ 7 Real-Time PCR System (ThermoFisher Scientific, #4453536). The relative quantification of gene expression was calculated using the 2-ΔΔCt method ...
-
bioRxiv - Bioengineering 2022Quote: ... and a QuantStudio 7 Flex qPCR machine (Applied Biosystems, Bleiswijk, The Netherlands), which was configured with 1 cycle of 10 min at 95 °C and 40 consecutive cycles of 15 s at 95 °C and 1 min at 60 °C ...