Labshake search
Citations for Thermo Fisher :
1 - 50 of 9269 citations for 7 Azaspiro 3.4 octane 6 8 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and mPRs (PAQR5, 6, 7, 8, 9) using Power SYBR Green Master Mix with ViiA 7 Real-Time PCR System (Applied Biosystems). RT-qPCR plates with various cell-lines were prepared using an epMotion 5075 automated liquid handling system (Eppendorf) ...
-
bioRxiv - Genetics 2019Quote: ... Day 6–7: DMEM (Gibco) with 25 mM glucose containing 1:100 B27 (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Cell Biology 2020Quote: ... −7 and −8 was standard KSR/KODMEM (Life Technologies) medium whilst MasterShef-10 and −11 were derived in Nutristem medium (Biological Industries) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.4 ul of Nuclease Free H2O (Ambion, AM9937), 0.2 µl of 20 µM Nested FW primer (5’ - AGGCTAAGGCTAATACATCTTCTG – 3’ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing 3.4% sodium dodecyl sulfate (Life Technologies, Gaithersburg, MD) for 10 minutes to allow color formation ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... 3.4 μL 0.2-μm dark red carboxylated microbeads (Invitrogen), 5 μL 10% APS and 1 μL TEMED ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.4 U/μL T7 polymerase (ThermoFisher, Cat EP0111) together at 37 °C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Pro-inflammatory cytokine (IL-8) and (IL-6) release was determined using the IL-6 and IL-8 ELISA kit (Invitrogen) according to the manufacturer’s instructions (ThermoFisher).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... dechorionated embryos were incubated in n-octane (Thermo Scientific Chemicals: 325950010) for 3 minutes to permeabilize the vitelline membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... All constructs were cloned in pcDNA 3.4 vector (ThermoFisher Scientific). Recombinant protein was expressed using Expi293F™ Cells (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... 3.4 μl of 1μg/μl mouse cot-1 (18440016, ThermoFisher) or human cot-1 (15279011 ...
-
bioRxiv - Immunology 2024Quote: ... The variable regions were cloned into pCDNA 3.4 (ThermoFisher Scientific) vectors previously constructed with a mouse IgKVIII signal sequence and each constant region ...
-
bioRxiv - Neuroscience 2022Quote: ... coated 6-well plates in Essential 8 medium (Gibco) and were passaged every 3 days using Versene (EDTA-based ...
-
bioRxiv - Neuroscience 2021Quote: ... at 6-7 days in vitro (DIV) or Lipofectamine 2000 (Thermofisher) 24/72 hours before the experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... iPSCs were passaged every 6-7 days with Versene (Life Technologies) at a 1:12 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Cell Biology 2020Quote: ... Human IL-6 and IL-8 ELISAs were from Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-8 μL Lipofectamine-LTX (15338100, Thermo Fisher Scientific, USA) was added to the plasmid solution which was then mixed and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were passaged every 6-7 days applying 0.5 mM EDTA (Thermofisher) in sterile Dulbecco’s Phosphate Buffered Saline (DPBS ...
-
bioRxiv - Plant Biology 2020Quote: ... controlled by the software Maps 3.4 VS (Thermo Fisher Scientific, Waltham, Massachusetts). The resulting stacks were scaled to a useable size (around 1000 × 1000 × 100 px ...
-
bioRxiv - Genetics 2023Quote: ... and the homozygote variant iPSCs were grown in a feeder-free manner on Matrigel (Corning)-coated 6-well plates in Essential 8 (E8) medium (ThermoFisher Scientific). Media was changed daily ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... with 8 kD dialysis membrane (SpectraPor 7 8000 Dalton MWCO; 11425919, Fisher Scientific UK). For syntaxin-6 the buffer used for dialysis was 10 mM Na-phosphate,150 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reactions were run on the QuantStudio 6 or 7 (ThermoFisher Scientific, Waltham, MA) using the qPCR reaction settings as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Cancer Biology 2022Quote: ... and ran on QuantStudioTM 6 Flex Real-Time PCR System using QuantStudioTM 6 and 7 Flex Real-Time PCR software v1.0 (Applied Biosystems). Relative gene expression levels were quantified using β-actin or human TBP as housekeeping genes ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: 8 × 104 HeLa cells were seeded in 6-well plates (Thermo Scientific) containing 22 × 22 mm glass coverslips ...
-
bioRxiv - Biophysics 2022Quote: ... was filled with 7-8 μL of sample and sealed with Critoseal (Fisherbrand, Fisher Scientific) at one end ...
-
bioRxiv - Immunology 2022Quote: ... Design and Analysis QuantStudio 6/7 Pro Systems Software (Thermo Fisher Scientific, Version 2.5.0) was used to identify amplification of genes and calculate fold change from Cq values ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Water extractable halides were measured using an ion chromatograph (Dione ICS-2100, Thermo Scientific). Soil (10 g ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly passaged undifferentiated cells were plated on hESC-qualified Matrigel (Corning 354277)-coated tissue-culture treated 6-well plates in Essential 8 media (Gibco A1517001) containing 10 uM ROCK inhibitor Y-27632 (Tocris 1254) ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... The PCR products were inserted into a modified pcDNA 3.4 expression vector (Thermo Fisher Scientific), and the nucleotide sequences were verified by DNA sequencing using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-ketocholestanol or phloretin cells were incubated with di-8-ANEPPS (Thermo Fisher, D3167) at a final concentration of 2 μM on ice for 20 minutes (33 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 and 8 hours using an EVOS FL Cell Imaging system (Thermo Fisher Scientific). Each experiment was performed on 5-6 litters for every treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... coated 6-well plates in Essential 8™ Basal Medium (E8; Gibco; A15169-01) supplemented with Antibiotic-Antimycotic (100x ...
-
bioRxiv - Biochemistry 2021Quote: ... Freshly prepared, ice-cold RIPA buffer (110 μL, 50mM Tris, pH 7-8 (Acros Organics #14050-0010), 150 mM NaCl (Fluka #71383) ...
-
bioRxiv - Immunology 2024Quote: ... Frozen lungs were cut into 7-8 µm sections using a Cryostar NX50 cryostat (Thermo Fisher Scientific) and mounted on silane-treated glass slides (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...