Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Neuroscience 2019Quote: ... and CellEvent caspase-3/7 reagent (ThermoFisher Scientific) were used according to manufacturer protocol ...
-
bioRxiv - Immunology 2022Quote: ... and Cell Event Caspase-3/7 Green (Invitrogen) were loaded at the final concentration of 5 µM and 7 µM respectively along with the cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase-3 and −7 Cell Imaging Kit (Invitrogen), and Propidium iodide (PI ...
-
bioRxiv - Systems Biology 2024Quote: ... CellEventTM Caspase 3/7 detection reagent (Invitrogen C10423), and SYTOXTM AAdvanced Dead Cell Stain (Invitrogen S10349) ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis induction was determined by activation of Caspase 3 and 7 using the CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen).H460 cells were plated at 5 × 103 cells/well in black 96 well plates with clear bottoms (Costar ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and visualized using FITC 488 nm filter ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... plates were treated with 2 μM of the CellEvent™Caspase-3/7 green detection reagent (Life Technologies, UK) for 60 minutes at 37 °C in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-desmocollin 2 and 3 (clone 7G6, Thermofisher), 1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSS117872 (Epsin-2) and HSS147867 (Epsin-3) (Invitrogen) on day 2 and 3 (Boucrot et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Passaged every 2-3 days with TrypleE (Gibco).
-
bioRxiv - Cell Biology 2022Quote: CellEvent® Caspase 3/7 Green (Thermo Fisher, UK) was used to evaluate cell apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... the CellEvent Caspase-3/7 Green Detection kit (Invitrogen) was used with propidium iodide as a viability marker ...
-
bioRxiv - Cell Biology 2023Quote: CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Cancer Biology 2022Quote: mScarlet-fascin/fascin KD or mScarlet/fascin KD HeLa cells were plated with 2 mM CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) in CellCarrier Ultra 384 well plates (PerkinElmer ...
-
bioRxiv - Zoology 2022Quote: ... 2.3 × 105 Huh-7 cells were transfected with 2 µg of pSpCas9-BB-2A-GFP-sgPURA using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Cell Biology 2020Quote: ... washed with 2 % FCS/PBS and then re-suspended in 2 % FCS/PBS containing 7-amino actinomycin (7-AAD, Invitrogen) at a concentration of 5 µg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...