Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 7α 12α Dihydroxycholest 4 en 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... All the probes of one set were pooled and en masse coupled with Alexa Fluor 647 (Thermo Fisher) or Texas Red ...
-
bioRxiv - Microbiology 2022Quote: ... One hundred nanomolar YOYO-3 Iodide (ThermoFisher Scientific) was added to label dead cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... media was changed to EN (50ng/mL EGF, Invitrogen, and 50nMol LDN-0193189 ...
-
bioRxiv - Immunology 2019Quote: One ml TRIzol reagent (4°C) (Invitrogen, 15596026) was added to ~20mg frozen splenic tissue in a 2ml microcentrifuge tube ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Biochemistry 2023Quote: ... 16 mL of HMA-10 buffer was added and the preparation was put on a shaking rocker for one hour at 4 °C with 3 units/mL Rnase-free Dnase (Ambion) added ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Genomics 2021Quote: ... One replicate was treated with blasticidin (Gibco, A1113903, 4 µg/mL), and the other replicate was not treated with blasticidin ...
-
bioRxiv - Developmental Biology 2022Quote: ... One volume of 4 °C DMEM (Thermo Fisher Scientific, Cat# 11960044) with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and 4 °C hold at one cycle (QuantStudio 3.0, Applied Biosystems). The mean Ct value of technical replicates from the standard curve was analyzed and plotted using The Graph Prism 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: The EN WT plasmid was transformed into BL21 Star (DE3) competent cells (Invitrogen) for large-scale expression ...
-
bioRxiv - Microbiology 2024Quote: ... The pDONR221 library was cloned en masse using Gateway LR Clonase II (Invitrogen) into randomly barcoded iBFG-Y2H vectors ...
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Genomics 2020Quote: ... Matching regions from 3 adjacent sections were collected on one Capsure Macro Cap (Thermofisher), region size permitting ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were stained for one hour before induction using SP- DiIC18(3) (Invitrogen, #D7777) to fluoresce at 564nm or DiIC18(5 ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Microbiology 2023Quote: 3’(4-Hydroxyphenyl)-fluorescein (HPF; Molecular Probes, OR, USA) was used for detecting •OH production (Avci et al. ...
-
bioRxiv - Physiology 2020Quote: ... muscles were stained for 3 minutes with 10μM 4-(4-diethylaminostyrl)-N-methylpyridinium iodide (4-Di-2ASP, Molecular Probes) to allow imaging muscle with an upright epifluorescence microscope (Leica DMR ...
-
bioRxiv - Biochemistry 2020Quote: ... The fluorogenic probe 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (abbr. CPM, ThermoFisher, Cat# D346) in 100% DMSO was then added to both quench the enzymatic reaction and react with CoASH to yield the fluorescent CPM-SCoA complex for fluorescence quantification 27 ...
-
bioRxiv - Cell Biology 2021Quote: ... One milligram of protein was incubated with 4 µg of antibody (IgG (Rb, Invitrogen) or HA (Rb ...
-
bioRxiv - Cancer Biology 2019Quote: ... Blots were blocked for one hour with 3% (weight/volume) bovine serum albumin (Fisher Scientific) and incubated overnight at 4° C with a rabbit monoclonal antibody to RHAMM [EPR4055] antibody at 1:1,000 dilution (Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined (Figure S4 ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids were washed with EN media and PBS and either resuspended in TRIzol LS (Thermo Fisher), freshly-made 4% PFA in PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Cell Biology 2020Quote: ... One portion was incubated for 16 h at 4°C with Dynabeads (Thermo Fisher Scientific) directly conjugated to anti-CD9 antibody with rotation ...
-
bioRxiv - Cancer Biology 2022Quote: ... proteins were separated by one-dimensional gel electrophoresis (4–12% NuPAGE Bis-Tris Gel; Invitrogen), and the entire lane of a Coomassie blue-stained gel was cut into 23 slices ...
-
bioRxiv - Molecular Biology 2019Quote: ... One fourth of the eluted samples was separated on 4-12% NuPage gels (Life Technologies) and the gels stained with coomassie blue (ProtoBlue ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures (n=3) were transferred as one sample into 250 μl RNAlater (ThermoFisher, Cat# AM7020) and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... in two pools of 5 in Gateway pDONR221 donor vector were further cloned into pOO2-GW via LR reactions of basic of Gateway Cloning Protocols (https://www.thermofisher.com/tw/en/home/life-science/cloning/gateway-cloning/protocols.html) using LR Clonase II enzyme (Invitrogen). For in vitro transcription ...