Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 7α 12α Dihydroxy 5β cholestan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... One hundred nanomolar YOYO-3 Iodide (ThermoFisher Scientific) was added to label dead cells ...
-
bioRxiv - Cell Biology 2022Quote: ... 10−6M 1,25 dihydroxy-cholecalciferol and 100 ng/ml LPS (Escherichia coli, 026:B6; ThermoFisher) or 10−7 M dexamethasone (Sigma Aldrich).
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Genomics 2020Quote: ... Matching regions from 3 adjacent sections were collected on one Capsure Macro Cap (Thermofisher), region size permitting ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were stained for one hour before induction using SP- DiIC18(3) (Invitrogen, #D7777) to fluoresce at 564nm or DiIC18(5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Blots were blocked for one hour with 3% (weight/volume) bovine serum albumin (Fisher Scientific) and incubated overnight at 4° C with a rabbit monoclonal antibody to RHAMM [EPR4055] antibody at 1:1,000 dilution (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures (n=3) were transferred as one sample into 250 μl RNAlater (ThermoFisher, Cat# AM7020) and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... The one-step RT-qPCR was run using a qPCR system (QuantStudio 3, Thermo Fisher Scientific, USA) with the following thermocycle ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were accomplished in one step in a QuantStudio 3 thermal cycler (Applied Biosystems) using the following incubation program ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 × 106 HEK293F cells were transfected with one of these constructs using 293fectin Transfection Reagent (Thermo Fisher) or 293-Free (EMD Millipore) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified using a Nanodrop One-One (Thermofisher) before cDNA amplification or RNA seq libaries preparation.
-
bioRxiv - Cancer Biology 2021Quote: ... 50,000 4T1 cells were injected and mice treated with either 1 or 3 doses of 8 mg/kg carboplatin or vehicle by tail vein injection staggered by one day with anti-VEGFR3 antibody (100 μg per injection × 3 total injections, I.P., eBioscience (now ThermoFisher), Control IgG ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative expression was calculated using the ΔΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative genomes were calculated using the ΔCT method ...
-
bioRxiv - Microbiology 2020Quote: ... one for virus quantitation (TCID50) and the other for vRNA extraction in TRIzol (ThermoFisher, 15596026; 1 in 3 dilution). Samples were stored at -80°C until required ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3) with 50 heating cycles at 94°C for 30 seconds ...
-
bioRxiv - Immunology 2024Quote: ... One cm pieces of small intestine were then incubated in HBSS containing 3 mM EDTA and 7.5% FBS (ThermoFisher) for 1 hour in a shaker at 37° C ...
-
bioRxiv - Immunology 2020Quote: ... mRNA concentrations were measured using Nanodrop One/One (Thermo Fisher), and 250 ng RNA of each sample was reverse transcribed to cDNA using the Primescript RT kit (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture One (Gibco), BDNF and GDNF (Peprotech) ...
-
bioRxiv - Microbiology 2023Quote: NanoDrop One (ThermoFisher), Qubit 3.0 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Microbiology 2021Quote: ... and 2 µL of total RNA was subjected to One-Step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Bioengineering 2022Quote: The DNA origami was folded in a one-pot reaction by gradually decreasing the temperature using a Proflex 3×32-well PCR system (ThermoFisher). The scaffold strands (p7249 and p7560 variants of single-stranded M13mp18 ...
-
bioRxiv - Biochemistry 2023Quote: ... 16 mL of HMA-10 buffer was added and the preparation was put on a shaking rocker for one hour at 4 °C with 3 units/mL Rnase-free Dnase (Ambion) added ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ probes FAM-ACCCCGCATTACGTTTGGTGGACC-QSY 3’) and Quantitative Superscript III Platinum One-step RT-qPCR systems with the ROX kit (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... The concentration was measured at NanoDrop One/One (Thermo Fisher Scientific) and the quality (RNA integrity number ...
-
bioRxiv - Biochemistry 2021Quote: ... Stained ovaries were finally mounted with one drop of vectashield in epoxy diagnostic slides (Thermo-Fisher Scientific, 3 wells 14 mm) and covered with high precision cover glasses ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2023Quote: ... A NanoDrop One (ThermoFisher) was used to measure the RNA concentration and purity ...
-
bioRxiv - Genomics 2023Quote: ... Nanodrop One (Fisher Scientific) for purity ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells from 2-D or 3-D cultures were harvested from one well of a 6-well plate and dissociated with Accutase (Thermo Fisher #A1110501), washed three times with 1x PBS ...
-
bioRxiv - Genomics 2022Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 μg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from one lung lobe collected at 3 dpi using lysing matrix D (MP Biomedical) containing 1 ml of TRIzol reagent (Ambion, Life technologies) and homogenization at 20 s at 4.0 m/s twice using MP Biomedical Fastprep 24 Tissue Homogenizer ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using OC43-nucleocapsid specific TaqMan primers and a probe 18 fluorescent- labelled with a 5’-FAM reporter dye and 3’-BHQ quencher (IDT) and AgPath-ID™ One-Step RT-PCR kit (AgPath AM1005, Applied Biosystems) on an ABI QuantStudio 3 platform (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 µg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... situated between nsP4 and the viral 3’ untranslated region (UTR) were reverse-transcribed and PCR-amplified using the SuperScript™ IV One-Step RT-PCR System (ThermoFisher, #12594025) and the 26S-F primer and pooled SinRev primer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 × 105 cells were seeded in one well of a 12-well plate on day 0 and counted on day one until day 3 with cell counters (Thermo Fisher Scientific). For colony formation ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Genetics 2020Quote: ... RNA was quantified using a NanoDrop™ One (#ND-ONE-W, ThermoFisher Scientific) and 2 μg per sample were used for cDNA synthesis by performing a retro-transcription reaction with the SuperScript™ VILO™ cDNA Synthesis Kit (#11754050 ...
-
bioRxiv - Microbiology 2021Quote: ... as measured by NanoDrop One/One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific) was loaded onto a 50-cm μPAC capLC column (PharmaFluidics ...
-
bioRxiv - Microbiology 2022Quote: NanoDrop One Microvolume UV-Vis spectrophotometer (Thermo Fisher Scientific, catalog #: ND-ONE-W).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA purity was assessed using a NanoDrop One (ThermoFisher Scientific, ND-ONE-W). The RNA samples (1μg ...
-
bioRxiv - Microbiology 2022Quote: ... One infected and one uninfected flask were treated with DSS Crosslinker (Thermo Scientific) following manufacturer instructions for intracellular crosslinking ...