Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 6H Pyrazino 1 2 c pyrimidin 6 one octahydro 2 7 dimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 6 μg of pcDNA-SARS-CoV-2-S(ΔC19) in 1 ml of Opti-MEM medium (ThermoFisher). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 60 WT and MafAS64F/+ islets from at least 6 female and male mice were analyzed with the ratiometric calcium indicator fura-2-acetoxymethylester (Fura-2 AM) (Life Technologies). Islets were maintained in 5 mM glucose for 30 min prior to measuring 11 mM glucose-induced calcium oscillations and depolarization-activated calcium influx with 30 mM KCl ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Plant Biology 2019Quote: ... coli or One Shot™ ccdB Survival™ 2 T1R Competent Cells (ThermoFisher Scientific). Depending on the selectable marker ...
-
bioRxiv - Plant Biology 2022Quote: ... Vectors were transformed into Escherichia coli One Shot OmniMAX 2 T1 (ThermoFisher Cat# C854003). CRISPR-Cas9 expression vectors carrying gRNA_W or gRNA_F were transformed in Agrobacterium tumefaciens (GV3101) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µM PAGE-purified primers and one unit of Platinum Taq DNA polymerase (Invitrogen). qPCR signal from a mock control lacking antibody was measured to determine the efficiency of recruitment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Inoculated cells were incubated for 1 h at 37°C and then overlaid with a 1:1 mixture of 1.2% Oxoid agar and 2× DMEM (Gibco) with 10% (vol/vol ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Neuroscience 2022Quote: [Ca2+]c was measured by ratiometric analysis using acetoxy-methyl-ester Fura-2 (Fura-2/AM; F1221 Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or 10 mM 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA, Thermo Fisher Scientific, Waltham, MA, USA). The cells stained with TMRE or NAO were incubated for 15 minutes at 37◦C whereas cells stained with HE and DCFH-DA were incubated for 30 minutes at 37◦C in the dark ...
-
bioRxiv - Immunology 2022Quote: ... The cells were incubated in presence of 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, 25 mM) (Invitrogen) for 30min at 37 °C and 5% of CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Microbiology 2021Quote: ... was assessed by the cell-permeant 2′,7′-dichlorodihydrofluorescein diacetate (CFDA) (10 µg/ml, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with 2 μM propidium iodide (PI) and 7 μM Hoechst 33342 (ThermoFisher) for 5-10 min and imaged under a Zeiss Observer Z1 microscope ...
-
bioRxiv - Physiology 2023Quote: ... followed by 7 days of decalcification with Shandon’s TBD-2 (Thermo Scientific, Waltham, MA, USA) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... SuperSignal Chemiluminescent substrate and 2’,7’-dichlorodihydrofluorescein diacetate acetyl ester (H2DCFDA) were from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cellular reactive oxygen species (ROS) levels were detected using 2’,7’ dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen). Cells were treated in the absence or presence of drugs for 48 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... Detection of SARS-CoV-2 N1 gene sequences and host RNase P mRNA from de-identified SARS-CoV-2 positive samples was carried out with the one-step TaqMan RNA-to-Ct 1-Step Kit (ThermoFisher), using 2 μL of undiluted PEARL extract ...
-
bioRxiv - Biochemistry 2020Quote: ... one µg of small RNAs was mixed with 2 µg of HPDP-Biotin (ThermoFisher Scientific, 1 mg/ml in DMSO). The reaction was incubated for three hours at room temperature protected from light and mixed every 15 minutes ...
-
bioRxiv - Genetics 2019Quote: ... BbsI-linearized piggyBac-U6 backbone was mixed with purified PCE product in a vector:insert 2:1 ratio and was directly used for transformation of One Shot MAX Efficiency DH5α-T1 Competent Cells (Invitrogen).
-
bioRxiv - Cell Biology 2023Quote: ... The lysates were digested overnight at 37°C with 1-2 µL of the Lys-C (125-05061, Wako) and trypsin mixtures (Pierce, Thermo Fisher Scientific) (10 ng/μL each) ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellet was resuspended in 1xPBS supplemented with 2 % fetal bovine serum (FBS, Hybclone) and 1 μg/mL 7-AAD (Life Technologies), filtered through a 40 μm strainer ...
-
bioRxiv - Genomics 2019Quote: ... followed by 2 hours at 55°C with proteinase K (ThermoFisher). Remaining DNA-protein complexes were decrosslinked by incubating for 16 hours at 65°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were then stained with DAPI (4’,6- diamidino-2-phenylindole, dihydrochloride, ThermoFisher, 62247 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...