Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: Samples were loaded with 5 μM Fluo-4 AM (ThermoFisher Scientific, Germany) in CM for 30 min in a cell culture incubator (37 °C and humidified 5% CO2) ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... After 4-5 minutes 30 µM SCH-23390 (Fisher Scientific Cat#: 092550) in ACSF was applied for 1 minute ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Immunology 2019Quote: One ml TRIzol reagent (4°C) (Invitrogen, 15596026) was added to ~20mg frozen splenic tissue in a 2ml microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:2000) and 4′,6-diamidino-2-phenylindole (DAPI, 1:1,000, Life Technologies). Following several washes ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-6 (1:4-1:2 dilution, #KMC0061; ThermoFisher Scientific, Waltham, MA, USA), and NfL (1:4 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Immunology 2020Quote: PBMC (1-2*10^6 cells) and pDC (1-4*10^4) were maintained for 16 h in RPMI1640+10% FBS+ 1% (PS) (Gibco Laboratories) in 96 well round bottom plates ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by overnight 4°C incubation with rabbit polyclonal antibodies against claudin-5 (1:100; Life Technologies) and ZO-1 (1:200 ...
-
bioRxiv - Genomics 2022Quote: ... 4 μl of 1 M CaCl2 and 5 μl of 100 U MNase (88216, Thermo Fisher Scientific) were added ...
-
bioRxiv - Microbiology 2023Quote: ... 5′-labelled Aar RNA (4 nM) was incubated for 1 h at 37°C with 1× structure buffer (Ambion), 1 µg yeast RNA and putative mRNA interaction partners at the indicated concentrations (0 nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 500 μL HEPES (25 mM)/PBS were mixed overnight at 4 °C with 5 μL of 4 μm aldehyde-activated latex beads (A37304, Invitrogen). The beads were blocked with 200 μL of 1% BSA for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Supernatant containing P1 virus was harvested ∼4 days post transfection and stored at 4°C after supplementing 5% FBS (Gibco). Expression of the Sec complex was carried out by adding 0.5 mL P1 virus to 0.7 L of Sf9 cells at density of ∼1.5 M/ml that were prepared in a 2-L baffled flask ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI – D1306, Life Technologies, 1:50000) fluorescent secondary antibodies were used in all immunocytochemistry experiments where applicable ...
-
bioRxiv - Physiology 2020Quote: ... and DAPI (4’,6-diamidino-2-phenylindole, 1 μg ml1; ThermoFisher, #D1306) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and counterstaining with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher, 1:10000) and phalloidin (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DAPI (4, 6-diamidino-2-phenylindole dihydrochloride; Invitrogen, D1306, 1:500).
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... were incubated for 4 h in DMEM/F12 containing 5% horse serum (Gibco) and 5% foetal bovine serum (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA (5 μg) was separated in 4-20% TBE gel (ThermoFisher scientific), described above.
-
bioRxiv - Microbiology 2021Quote: ... 14.5 μl of preheated reaction mixture [4 μl First Strand buffer (5 ×, Invitrogen), 1 μl 0.1 M dithiothreitol ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...