Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: CellEvent® Caspase 3/7 Green (Thermo Fisher, UK) was used to evaluate cell apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... the CellEvent Caspase-3/7 Green Detection kit (Invitrogen) was used with propidium iodide as a viability marker ...
-
bioRxiv - Neuroscience 2023Quote: ... To revive hiPSCs from cryopreservation cells were thawed by incubation for 2 minutes at 37°C and retrieved by centrifugation (200 x g for 3 minutes) prior to resuspension in Essential 8 (E8, (A1517001, Life Technologies) medium with 1’RevitaCell ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... 3.7 g/l sodium bicarbonate and sodium pyruvate) (AL007A, HiMedia, Mumbai, Maharashtra, India) supplemented with 10% FBS (10270-106, GIBCO-Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293T cells were plated in 6 well plates at 8 x 10^5 cells / well with DMEM / 10% FBS / NEAA / Pen-Strep (Gibco). Cells growing at ∼70-80% confluency were transfected with 1 μg of the desired expression plasmid (Sigma Aldrich ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... using 3–5 µg of primary antibody against each protein and protein-G magnetic Dynabeads (10003D, Invitrogen) and incubated overnight at 4°C on rotation ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and visualized using FITC 488 nm filter ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... plates were treated with 2 μM of the CellEvent™Caspase-3/7 green detection reagent (Life Technologies, UK) for 60 minutes at 37 °C in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2022Quote: Hemolymph sporozoites collected on days 19 to 24 post-infection were centrifuged for 5 min at 450 x g and 4 °C in an 8-well Lab-Tek chamber slide (Nunc) or a 384-well plate (Greiner) ...
-
bioRxiv - Plant Biology 2020Quote: ... The luminescence was detected for 5-6h with a signal integration time of 2min using Varioskan Flash plate reader (Thermo Fisher Scientific). For determining the effects of chemical inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2×10^5 cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cell Biology 2021Quote: ... and a mini-pump machine (13-876-2, Thermo Fisher, USA) under general anesthesia ...
-
bioRxiv - Physiology 2021Quote: ... mouse-anti Microtubule-associated protein 2 (MAP2) (Invitrogen, Cat # 13-1500) (1:1000) ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... or NuPAGE 3-8% Tris-Acetate Gels (Invitrogen) and transferred to Immun-Blot PVDF membrane (Bio-rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 3-8% Tris-Acetate gels (Thermo Fisher) for gel electrophoresis depending on the protein sizes of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific) gels and then transferred to 0.22 μm nitrocellulose membranes ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 3–8%Tris-Acetate (Thermo Fisher Scientific) gradient gels ...
-
bioRxiv - Biophysics 2020Quote: ... NuPAGE Novex 3%-8% Tris-Acetate Gel (Invitrogen) was used ...
-
bioRxiv - Immunology 2023Quote: ... or 3-8% TA gels (Thermo Fisher Scientific) in TA buffer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... or a 3-8% Tris Acetate gel (Invitrogen). Proteins were wet transferred onto a PDVF membrane (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... or NuPage Tris-Acetate 3-8% gels (Invitrogen), for detection of TIR-1 ...
-
bioRxiv - Immunology 2024Quote: ... or NuPage Tris-Acetate 3-8% gels (Invitrogen), for detection of TIR-1::3xFLAG ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 μM 7-hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one) succinimidyl ester (DDAO-SE) (Invitrogen) in HMI11 and incubated for 20 min at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3 g/L trisodium citrate (Fisher Scientific); 2 g/L KCl (Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 g select agar (Life Technologies) were added to 300 ml of distilled water and autoclaved ...
-
bioRxiv - Genomics 2022Quote: ... 2 g/L NaHCO3 (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... 2 g/L NaHCO3 (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... The bacterial cells were stained with 5 μM Syto 9 (Invitrogen) and fungal cells were counter-stained with 2 μg/mL calcofluor white (Fluka ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were counterstained with 5 μM of SYTO 9 Green (Invitrogen) for 10 minutes on ice ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 mM EDTA pH 8 (Invitrogen 15575), and 100 mM Tris-HCl pH 7.2 (Sigma T2069 ...
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... chilled on ice for 5 min and electrophoresed in a 3 – 8% Tris-Acetate NuPAGE gel (Novex Life Technologies). Transfer of the proteins onto a nitrocellulose membrane was done in transfer buffer (5% methanol ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...