Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Plant Biology 2024Quote: ... for 6h at 4°C and an additional 2h at 4°C with 20μl Dynabeads Protein G (#10003D, ThermoFisher) blocked with 0.1% BSA ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2022Quote: ... and the vesicular stomatitis virus G (VSV-G)-expressing plasmid at a ratio of 7:7:1 (5 μg total amount of DNA) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Immunology 2019Quote: ... IL-7 (5 ng ml−1; ThermoFisher), and IL-15 (5 ng ml−1 ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Developmental Biology 2024Quote: Ovaries from 5-7 females were dissected in 1% PBS-Tween and fixed in a 1:1 mixture of 4% formaldehyde (Thermo Scientific, 28908) and heptane (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 g L−1 NaCl (Fisher Scientific)) with appropriate antibiotics for all the experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4) Opal 620/anti-TdT (1:8, SEN28, Invitrogen), 5 ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Microbiology 2022Quote: The PfHDAC1-2xFKBP-GFP knockin NF54 line parasitized RBCs (mock or 100 nM dihydro artemisinin treated from ∼21-24 HPI/3 hours) were crosslinked using 1% formaldehyde (Thermo Scientific, 28908) for 10 mins at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells with Fzd1/2/4/5/7/8 knocked out were provided by Michael Boutros (Voloshanenko et al., 2017) and maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gemini) ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... Reverse 5′-CGA AGG TGT GAC TTC CAT G-3′) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Immunology 2020Quote: ... 50 µL of 2 µg/mL purified RBD-6H as described above was coated on flat-bottomed 96-well plates (Immunon 4 HBX; Thermo Fisher Scientific) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Genetics 2019Quote: ... and 5 µl of protein A: protein G 1:1 Dynabeads (Thermofisher). Antibody-bond chromatin was washed four times in low salt buffer (20 mM Tris-HCl pH 8.0 ...