Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6H 1 2 Thiazine 6 ethoxy 5 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; Life Technologies) was used to counterstain cell nuclei ...
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, D3571) 1:1000 in 1% BSA included in the second wash ...
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Cell Biology 2019Quote: ... TaqMan primers 5′ end labeled with 6-carboxyfluorescein (FAM; ThermoFisher), and cDNA diluted per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μl of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA, Pierce) with 1% trimethylchlorosilane (1% TMCS, Thermo Scientific) was added to react for 30 min in 60°C ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Physiology 2022Quote: ... 60 μL of N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA with 1%TMCS, ThermoFisher Scientific #TS48913) was added automatically via the auto sampler and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and Nuclear DNA was counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher). Alternatively ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...