Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 methyl 2 3 pyridinedicarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, 62248) was used to eliminate dead cells ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Biophysics 2023Quote: ... and 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) from Thermofisher Scientific (USA) ...
-
bioRxiv - Immunology 2023Quote: ... 2-6 mL (Thermo Fisher Scientific/ Pierce, 88521) Pierce™ Protein Concentrators PES ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific). IHC and IF stained slides were imaged using the Olympus BX53F epifluorescence microscope (Center Valley ...
-
Polarized Mechanosensitive Signaling Domains Protect Arterial Endothelial Cells Against InflammationbioRxiv - Cell Biology 2023Quote: ... Laurdan dye (6- Dodecanoyl-2-Dimethylaminonaphthalene) (Invitrogen #D250) was applied at 10 μM to cell monolayers and incubated 30 min at 37°C then washed and imaged in 1X HBSS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, 10,116,287) and mounted on slides with Fluoromount-G from Southern biotech (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2– 6 mL (Thermo Fisher Scientific/ Pierce, 88538). Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific/Pierce ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies #D3571) for 10 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D3571) was added for 5 minutes in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Microbiology 2020Quote: ... were acid digested on a hot plate using 6 mL Primar Plus grade HNO3 (68%) and 2 mL H2O2 (Thermo Fisher Scientific, Loughborough, UK). Samples were diluted with Milli-Q water (18.2 MΩ cm ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Roughly 1/3 of the plate (2-3 loopfuls) were added to 400 µl 1x Tris-Ethylenediaminetetraacetic acid (EDTA) pH 7.5 (Thermo Scientific, Waltham, USA) and heated at 80 ºC for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: Sample digests were acidified with formic acid to a pH of 2-3 prior to desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for LC-MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...