Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6 Quinoxalinamine N 3 8 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were loaded onto a NuPAGE® Novex® 3–8% Tris-Acetate Gel3–8% (Thermo Fisher Scientific) and run in Novex Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Northern blots were performed as previously described with infrared probe and EDC (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide) (Thermo Scientific) crosslinking43 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Glycerol-3-Phosphate (cat. N° 20729) were from Cayman. Schneideŕs Drosophila medium (cat. N° 21720024) was from Gibco. ADP ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3%-8% NuPAGE Tris-Acetate Protein Gels (Thermo Fisher Scientific) for high molecular weight proteins ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Gradient gels (3% - 8% Tris-acetate protein gels, Thermo Fisher Scientific) were loaded with the lysates and run for 55 min at 150 V in Tris-tricine buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... In a NuPAGE 3-8 % Tris-Acetate gel (NOVEX Life Technologies), 15 μg protein was loaded with 5 x loading buffer (0.05 % Bromophenol Blue ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were resolved by Tris-acetate NOVEX NuPAGE 3-8% (Invitrogen) (SorLAFL and SorLA2131 ...
-
bioRxiv - Molecular Biology 2022Quote: ... IP samples were analyzed on 3–8% tris-glycine gels (Invitrogen). Additionally ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein lysates were resolved on 3-8% (Thermo Fisher Scientific EA0375BOX) or 4-12% gradient SDS-PAGE gels (Thermo Fisher Scientific NP0321BOX) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly passaged undifferentiated cells were plated on hESC-qualified Matrigel (Corning 354277)-coated tissue-culture treated 6-well plates in Essential 8 media (Gibco A1517001) containing 10 uM ROCK inhibitor Y-27632 (Tocris 1254) ...
-
bioRxiv - Neuroscience 2022Quote: Milk samples (n = 8) were placed onto a Mini Tube Rotator (Fisher Scientific Cat. #88861051) overnight at 4°C to homogenize prior to analysis ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... The 6-well plates were previously coated with Vitronectin-N (Thermo Fisher Scientific; A14700). Y-27632 (Fujifilm Wako ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Neuroscience 2023Quote: ... saline (N = 7) or muscimol (N = 8, conjugate of muscimol and the Bodipy TMR-X fluorophore, InvitrogenTM; purchased from Thermo Fisher Scientific, reference M23400) disolved in PBS (ph 7.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-ketocholestanol or phloretin cells were incubated with di-8-ANEPPS (Thermo Fisher, D3167) at a final concentration of 2 μM on ice for 20 minutes (33 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 and 8 hours using an EVOS FL Cell Imaging system (Thermo Fisher Scientific). Each experiment was performed on 5-6 litters for every treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... coated 6-well plates in Essential 8™ Basal Medium (E8; Gibco; A15169-01) supplemented with Antibiotic-Antimycotic (100x ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded onto NuPAGE 3-8 % Tris-Acetate gradient gels (ThermoFisher) prior to transfer onto PVDF membrane ...
-
bioRxiv - Immunology 2021Quote: ... Eluted proteins were run on a 3-8% Tris Acetate Gel (Invitrogen) or 4-12% Tris Bis gel (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... Lysates were separated by 3%–8% Tris-Acetate SDS-Page (Thermo fisher) and probed against rabbit IP3R1 (1:1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were run on 3-8% Tris-Acetate gels (Thermo Fisher, 12095655). Prestained protein ladder (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... The sample was run on a 3-8% Tris Acetate Gel (Invitrogen) for 1 hour at 150 V ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclear extracts were separated using 3–8% Tris-Acetate gradient gels (Invitrogen). Total proteins on the gel were transferred to a PVDF membrane (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2020Quote: ... gels or NuPage Tris-Acetate 3-8% gels (Invitrogen, Carlsbad, CA, USA). Proteins were transferred using iBlot dry transfer system (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were separated using 3-8% Tris-Acetate gels (Invitrogen, Carlsbad, CA) and visualized after western blotting ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein extracts were resolved on 3%–8% NuPAGE Tris-acetate gels (Invitrogen) and transferred onto PVDF membranes (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then loaded on NuPAGE 3-8% Tris-Acetate gels (Invitrogen). Western blots were performed using iBlot 2 Gel Transfer Stacks PVDF system (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were separated by NuPAGE 3-8% Tris-Acetate SDS-PAGE (Invitrogen) in duplicate sets ...
-
bioRxiv - Biophysics 2022Quote: Samples were run on a 3-8% pre-casted gels (Thermo Scientific), in 1xTA buffer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclear extracts were resolved using 3–8% Tris-Acetate gradient gels (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... Worm extracts were loaded on NuPAGE 3-8% Tris Acetate gels (Invitrogen). Proteins were then transferred onto nitro-cellulose membranes which were incubated with 1 µg/µL primary antibodies in 1X TBS-Tween (TBS-T ...
-
bioRxiv - Genetics 2023Quote: ... Protein was separated on 3 to 8% NuPAGE Tris-Acetate gel (Invitrogen) and transferred to PVDF membrane ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were subsequently loaded onto NuPAGE™ 3–8% Tris-Acetate (Invitrogen) and NativePAGE™ 4–16% ...
-
bioRxiv - Genetics 2024Quote: ... and separated by 3–8% NuPAGE™ Tris-Acetate gels (EA0375BOX, Invitrogen). Then the resolved proteins were transferred to 0.45 μm PVDF membranes (Merck Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2020Quote: Cell culture supernatant (diluted ¼) was subjected to ELISA (TNFα, Thermo Scientific, Waltham, MA, n=6) and Luminex (Cytokine Human Magnetic 30 Plex Panel ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...
-
bioRxiv - Cell Biology 2020Quote: ... Adult cardiac NMCs were isolated from adult C56BL/6 mice (6-8 weeks old) by digesting adult ventricles in buffer containing 1 mg/ml collagenase IV (Gibco 17104-019) and 1.2 mg/ml dispase II (Sigma ...