Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Propyl 3 pyridinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Bioengineering 2022Quote: Hydrogels for nanoindentation were fabricated on coverslips functionalized with 3-(Trimethoxysilyl)propyl methacrylate (Fisher Scientific) as previously described.[39] Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µL n-propyl gallate solution (50 mg/mL n-propyl gallate (MP210274780, Thermo Fisher Scientific) and 16.3 mg/mL Tris base (648310 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were washed and mounted in media (0.5% N propyl gallate, 70% glycerol, 1M tris pH8.0) containing 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Cat. No. D1306).
-
bioRxiv - Microbiology 2020Quote: ... propyl iodide (PI) and Hoechst from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Bioengineering 2020Quote: ... Approximately 7 μL AMCC-laden gel precursor solution was photocrosslinked with visible light (405 nm, 10 mW/cm2) between a 180 μL tall spacer and a 3-(trimethoxysilyl) propyl methacrylate (ACROS Organics) coated glass slide for 45 s (0.25 s/μm of hydrogel thickness) ...
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... coverslips were washed once with PBS and before mounting on objective glass with 6% n-propyl gallate diluted in glycerol and 10x PBS and combined with ShandonTM Immuno-MountTM (Thermo Scientific, cat# 9990402) in a 1:12 ratio ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with various concentrations of propylparaben (Propyl 4-hydroxybenzoate, PP; Acros Organics, CAT: 131591000), methylparaben (Methyl 4-hydroxybenzoate ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... HCT8 cells were grown on a 6-well slide (3×105/well, Thermo Scientific) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells (3×105) were seeded in a 6 well plate (Nunc,Thermo,USA) with DMEM media (Invitrogen,USA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Spheroids pictures were taken after 3 and 6 days using EVOS FL microscope (Thermofisher) and the images were analyzed with ImageJ software ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... heated for 3 mins at 90C and separated on a 6% denaturing PAGE gel (Invitrogen). The RNA was then transferred to a HyBond-N+ nylon membrane (GE Life Sciences ...
-
bioRxiv - Neuroscience 2023Quote: Primary mouse microglia were plated at a density of 3×105 in 6 well plates and treated for 6 h prior to RNA extraction with Trizol (Invitrogen; Taïb et al., 2013). Adult microglia were treated as described in section 2.2.3 prior to extraction of total RNA using RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Bioengineering 2022Quote: ... and 3 mM N-[3-[(4-benzoylphenyl) formamido]propyl] methacrylamide (BPMAC, custom synthesis, PharmAgra) in 1x Dulbecco’s phosphate buffered saline (DPBS, 10x stock, 14200075, ThermoFisher). First ...