Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.2 mM 1-phenyl-2-thiourea (Acros Organics) for 24 h from 1 to 2 dpf.
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM disuccinimidyl suberate (DSS) or 2 mM tert-butyl disuccinimidyl phenyl phosphonate (tBu-PhoX)(Thermo Fisher Scientific) in DMSO was added to the solution and incubated for 1 hr at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... The styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64, 514/670 nm absorption/emission Invitrogen™, Waltham, Massachusetts) was used at a final concentration of 16.5 μM in ddH2O from a 16.5 mM stock solution in DMSO ...
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Plant Biology 2019Quote: ... pollinated stigma was incubated in FM™ 4-64 Dye (N-3-Triethylammoniumpropyl-4-6-4-Diethylamino Phenyl Hexatrienyl Pyridinium Dibromide, Life Technologies T3166, 8.23 μM) for five minutes and subsequently washed in 1/2 Murashige and Skoog basal medium containing 10 % (w/v ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Biophysics 2021Quote: ... Membranes were stained with 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate (TMA-DPH; Molecular Probes) at a final concentration of 100 μM and the cells were then immobilized on a 2% agarose pad made with sporulation buffer covered with a no.1.5 coverslip ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants were aspirated and pellets were resuspended in 3-5 µL of 1X PBS containing 0.02 mM 1-(4-(trimethylamino) phenyl)-6-phenylhexa-1,3,5-triene (TMA-DPH)(Invitrogen).Cells were mounted on glass slides with polylysine-treated coverslips ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...