Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Systems Biology 2022Quote: ... 6-Diamidino-2-phenylindole (DAPI) staining Hoechst (Invitrogen 33342) was used and added to the secondary antibody staining solution at a dilution of 1:500 ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Zoology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, CA, USA) in dd H2O for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; Life Technologies) was used to counterstain cell nuclei ...
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, D3571) 1:1000 in 1% BSA included in the second wash ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...