Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 6 Nitropyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2 phenylindole (DAPI; Cat. P36941, Invitrogen, Carlsbad, CA) and visualized on a Leica Stellaris confocal microscope using a 63x oil immersion objective ...
-
bioRxiv - Bioengineering 2023Quote: ... All samples were then incubated with 4′,6-Diamidino-2-phenylindole (DAPI, 2 µM, Thermofisher) as a nuclear counterstain and Alexafluor 555 phalloidin (1:60 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 mmol/L ethylenediaminetetraacetic acid) and stained with 2 μg/mL propidium iodide (PI; Invitrogen). PI was added just before the analysis ...
-
bioRxiv - Immunology 2024Quote: ... 25 mM N-2-hydroxy-ethylpiperazine-N′-2-ethanesulfonic acid (HEPES, Gibco, Grand Island, NY, USA), 100 U/mL penicillin and streptomycin (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and reaction was stopped with 2 N sulfuric acid (Fisher Scientific). Optical density at 450 and 620 nm was captured with SpectraMax M2 (Molecular Devices) ...
-
bioRxiv - Bioengineering 2019Quote: ... 0.27 µM Fura-2-AM and 0.1% pluronic acid (Invitrogen, USA) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μM dodecanoic acid (FA12) labelled with BODIPY (Molecular probes #D3822) diluted in serum-free DMEM + 10 μg/ml insulin was added to the adipocytes and incubated for 5-60 min at 37°C followed by FACS ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM L-glutamine and non-essential amino acids (ThermoFisher Scientific), supplemented with 100 U/mL Il-2 (Roche) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM L-glutamine and non-essential amino acid (ThermoFisher Scientific). Both NK-92 and K562 cells were maintained in 37°C ...
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM L-glutamine and 90% non-essential amino acids (Gibco), 10% heat-inactivated Fetal Bovine Serum (FBS ...
-
Mycobacteria form viable cell wall-deficient cells that are undetectable by conventional diagnosticsbioRxiv - Microbiology 2022Quote: ... Nucleic acids were stained using 2 µM SYTO 9 (S34854, Invitrogen). The plasma membrane was labelled using SynapseRed C2M (SynapseRed ...
-
bioRxiv - Microbiology 2023Quote: GAG was subjected to acid hydrolysis with 2 M HCl (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... 2% MEM amino acids (from 50X stock; Gibco catalog number 11130051), 1% MEM vitamin solution (from 100X stock ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mL of 70 % (v/v) concentrated nitric acid (Fisher Scientific) was added to each sample ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Neuroscience 2022Quote: ... NPC cultures received 100 pM acetic acid vehicle or 100 ng/ml IL-6 (Gibco; PHC0066) on day 18 for 3h ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells (2 × 105) were plated in 6 well culture dishes (Nunc™ ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI, 0.1 mg/ml, D1306; Molecular Probes) was added into the incubation solution to visualize cell nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...