Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Methyl 5 nitropicolinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM methyl-β-cyclodextrin (Acros Organics, NJ) (mβCD ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco, MA]/44 mM sodium bicarbonate [Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μg/mL ascorbic acid (Gibco), and 2.16 g/mL β-glycerolphosphate (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: All fly lines were maintained in mixed sex groups in bottles on JazzMix media or our own food made following the same recipe (brown sugar, corn meal, yeast, agar, benzoic acid, methyl paraben and propionic acid; Fisher Scientific, Whitby, ON, Canada) at 25°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) was added to each well at least 1 hour before images were taken ...
-
bioRxiv - Microbiology 2022Quote: Paecilomyces AF001 and Wickerhamomyces SE3 were grown on palmitoleic and pentadecanoic acid methyl esters (Fisher Scientific, Waltham, MA) to determine their capacity on using these substrates for growth ...
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% (v/v) acetic acid) (ThermoFisher, A40000279) to visualize the proteins run on the paper ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% non-essential amino acids (NEAA, ThermoFisher Scientific), 1% 2-Mercaptoethanol ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 ml MEM Non-Essential Amino Acids (Gibco), 5 ml Sodium pyruvate solution (100 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 mL acid phenol: chloroform 5: 1 (Ambion), and 50 mL 0.5 mm zirconia/silica beads (BioSpec) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5% non-essential amino acids (NEAA, ThermoFisher). The BMK-dko cell line was a kind gift from the originator Eileen White ...
-
bioRxiv - Immunology 2023Quote: ... and 5 g/L casamino acids (Gibco, 223120) in deionized water] ...
-
bioRxiv - Plant Biology 2023Quote: ... The released methyl glycosides and methyl glycoside methyl-esters were then reacted for 30 min at 80 °C with Tri-Sil® (ThermoFisher, USA). GC-EI-MS analysis of the TMS methyl glycosides was performed on an Agilent 7890A GC interfaced to an Agilent 5975C mass selective detector ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried material was dissolved in 300 μl of 6:1 (v/v) of methyl sulphoxide D6 (99.9% atom D + 1% tetramethylsilane, ACROS Organics):D2O (100% atom D ...
-
bioRxiv - Molecular Biology 2022Quote: ... methyl pyruvate (Thermo Scientific™), methyl aspartate (Santa Cruz ...
-
bioRxiv - Cell Biology 2019Quote: ... methyl ester (TMRM; ThermoFisher Scientific) staining using a microplate reader ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... methyl ester (TMRM) (Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... methyl ester (TMRM) (ThermoFisher, I34361) to visualize active mitochondria ...
-
bioRxiv - Pathology 2023Quote: Tetramethylrhodamine methyl ester (TMRM) (Invitrogen) in self-quenching mode (1.5 µM ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5% Non-Essential Amino Acids (Thermo Fisher Scientific). The use of patient fibroblasts was approved by the Ethics Committees of the Hospital District of Helsinki and Uusimaa (HUS 387/13/03/2009 and HUS/1187/2019) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mL non-essential amino acids (Gibco, Cat# 11140050), 5 mL GlutaMax (Gibco ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco) ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...