Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... one primer was 5’ phosphorylated using a T4 Polynucleotide Kinase (ThermoFisher) using recommended reaction conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed 3 times in PBST and mounted in 4′,6-diamidino-2-phenylindole (DAPI)-containing ProLong Anti-fade Diamond mountant (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... The samples were washed again in PBS for 3×15 min and mounted in DAPI (4-,6-diamidino-2-phenylindole; Life Technologies, D1306) for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded at 3 μl/min for 6 min onto a 2 cm × 75 μm C18 trap column (Acclaim Pepmap 100, 3 μm, 300 Å, Thermo Scientific) in loading buffer (0.5% v/v formic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotinylation of Htz1(V126C) was carried out using N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)propionamide (HPDP-Biotin) (Thermo Fisher cat. # 21341), which has a pyridyl disulfide moiety ...
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Pathology 2023Quote: ... which was previously labeled at its 5’ end with one of four specific fluorescent dyes (6-FAM®, NED®, PETTM and VICTM; Thermo Fisher Scientific, Waltham, MA, U.S.A) (Table 2) ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... methyl ester (TMRM) (Cat# I34361, Invitrogen) and 1ug/ml Hoechst 33342 (Cat# H3570 ...
-
bioRxiv - Immunology 2021Quote: ... methyl ester (TMRM; Invitrogen cat #T668) in serum-free RPMI media for 45 minutes at 37°C per manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Tetramethylrhodamine methyl ester perchlorate (TMRM, Invitrogen) was used to stain cells at concentrations of 50 or 10 nM ...
-
bioRxiv - Microbiology 2023Quote: ... MES and methyl-salicylate (ACROS Organics); sodium ferulate (Selleck Chemical) ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl ester (TMRM, Thermo Fisher Scientific). Cells were loaded with 20 nM TMRM for 30 minutes at 37°C and then transferred to the imaging system ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in one well of 6 well plates were collected in ice-cold PBS (Gibco) and lysed in 200 µL lysis buffer (50 mM Tris-HCl pH 7.0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), was added to the media of the IL-6 dependent myeloma cell lines INA-6 ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 were seeded in 6-well plates (Falcon) with one glass coverslip (Fisher Scientific) per well ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were washed extensively with PBS and activated via photoirradiation (365 nm, 0.8 mW for 5 minutes) with sulfosuccinimidyl-6-4’-azido-2’-nitrophenylamino hexanoate (Sulfo-SANPAH; Thermo Scientific Pierce). To do so ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.