Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 Methoxypyridazine 3 Carboxylic Acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Biophysics 2020Quote: ... Pab1 RRM12 and Pub1 RRM123 proteins were purified as described above and were labelled with Alexa Fluor 488 or Alexa Fluor 647 carboxylic acid succinimidyl ester dyes (Molecular Probes), using protein to probe ratios of 1:3 ...
-
bioRxiv - Immunology 2023Quote: ... The 14.4.4 mAb and the I-Ak-reactive 11-5.2 mAb were randomly labeled via available lysine residues with Alexa Fluor 647 carboxylic acid succinimidyl ester (Thermo Fisher Scientific) according to the manufacturer’s instructions and purified via gel filtration (Superdex-200 10/300 GL ...
-
bioRxiv - Biochemistry 2023Quote: INIP and the TRR complex were labeled on N-termini using AF488 dye (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Before labeling ...
-
bioRxiv - Immunology 2023Quote: 4CMenB OMVs were fluorescently labelled targeting lysine residues with Alexa Fluor 488 (Alexa Fluor 488 carboxylic acid, succinimidyl ester, Invitrogen, A20000). OMVs were concentrated to 20 mg/ml in PBS 1× pH 7.2 ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was then heated to 55 °C and held for 45 min before purification using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Biophysics 2020Quote: ... The confocal parameters were calibrated daily by measuring the FCS decay of a 20 nM TAMRA (carboxylic acid of tetramethyl rhodamine) free dye solution (Molecular Probes, Inc.) with a known diffusion coefficient (D = 420 μm2s−1 ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Neuroscience 2019Quote: The PSR1 beads were generated by chemical conjugation of a thiolated PSR1 peptoid derivative to magnetic beads (Dynabeads™ M-270 Carboxylic Acid, Invitrogen, Carlsbad CA) as described previously and were provided as a 30mg/ml suspension of beads in bead storage buffer (1xPBS with 0.1% Sodium Azide ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific, Cat. # A20000) following Ref ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and the wells were washed five times with wash buffer before the addition of 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid (ABTS, #37615, Thermo Fisher Scientific). Optical density was read 40 min later at 405 nm using a plate reader (SpectraMax i3 ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) was added to each well at least 1 hour before images were taken ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3-mercaptopropionic acid were purchased from ACROS ORGANICS. Hydrogen tetrachloroaurate(III ...
-
bioRxiv - Developmental Biology 2023Quote: ... acidified to pH2-3 by trifluoroacetic acid (Thermofisher, 85183), and desalted with a Pierce C18 spin column (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Pathology 2020Quote: ... citric acid (Fisher Scientific, Cat. No. A104-3, Hampton, NH), sodium phosphate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled to a pH of 7.4 with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...