Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Methoxy 3 methyl 1H indazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM triazole ligand Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amin (TBTA, Thermo Fisher Scientific, 454531000), 62.5 μM biotin-alkyne tag (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Microbiology 2024Quote: ... Xanthine and 3-methyl xanthine were purchased from Acros Organics (Antwerpen, Belgium). 1-methyl xanthine and Paraxanthine were purchased from ChemScene (Monmouth Junction ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Microbiology 2024Quote: ... and stained with 2-(4amidinophenyl)-1H-indole-6-carboxamidine (DAPI, 1 μg/mL; Invitrogen, D1306) and washed with Dulbecco’s PBS ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2023Quote: ... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... the retinal sections were mounted with Fluoromount G™ containing 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI, Invitrogen) for nuclei detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2022Quote: ... then disaggregated and labelled with 1,1’-di-octa-decyl-3,3,3’,3’-tetra-methyl-indo-carbo-cya-nine perchlorate (DiI, ThermoFisher) and finally resuspended in a buffer containing 5% FBS in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Plant Biology 2023Quote: ... The released methyl glycosides and methyl glycoside methyl-esters were then reacted for 30 min at 80 °C with Tri-Sil® (ThermoFisher, USA). GC-EI-MS analysis of the TMS methyl glycosides was performed on an Agilent 7890A GC interfaced to an Agilent 5975C mass selective detector ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.173% 2-methoxy(polyethyleneoxy)propyltrimethoxysilane (Gelest, SIM6492.7) and 0.62% n- butylamine (Acros Organics) with flowing nitrogen gas for 90 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried material was dissolved in 300 μl of 6:1 (v/v) of methyl sulphoxide D6 (99.9% atom D + 1% tetramethylsilane, ACROS Organics):D2O (100% atom D ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Molecular Biology 2022Quote: ... methyl pyruvate (Thermo Scientific™), methyl aspartate (Santa Cruz ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... methyl ester (TMRM) (ThermoFisher, I34361) to visualize active mitochondria ...
-
bioRxiv - Pathology 2023Quote: Tetramethylrhodamine methyl ester (TMRM) (Invitrogen) in self-quenching mode (1.5 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... methyl ester (TMRM, T668, Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... Aqueous 0.85% w/v methyl cellulose was prepared by dissolving powdered methyl cellulose (Thermo Scientific Chemicals ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... BODIPYTM-C12 500/510-C1 (4,4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid; Invitrogen) or BODIPYTM-C12 558/568 (4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... tissues were incubated with a species-specific secondary antibody (Alexa 647) for 1h then washed 3 times with PBS and mounted using ProLong Gold Antifade Mountant with DAPI (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... Following another 3 washes with PBS plates were incubated for 1h with secondary goat anti-guinea pig-AlexaFluor488 (Invitrogen, UK) at 1:500 in PBS-0.5%BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the slides were washed 3 times with PBS and incubated for 1h at room temperature with goat anti-rabbit AlexaFluor-568 (ThermoFisher, Invitrogen A-1101 ...