Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ● Magnesium chloride (MgCl2) (Fisher Scientific).
-
bioRxiv - Bioengineering 2024Quote: ... 1.84M sodium chloride (Invitrogen AM9759) and 1.45X PBS 1mL (Invitrogen AM9625 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 kDa methoxy-poly(ethylene glycol)-succinimidyl valerate (mPEG-SVA) (ThermoFisher Scientific, Waltham, MA), 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Physiology 2020Quote: ... 9 mM magnesium chloride (MgCl2, Invitrogen), 1 μ Template-Switching Oligo (Exiqon ...
-
bioRxiv - Neuroscience 2020Quote: ... magnesium chloride and magnesium sulfate (Gibco) for 27 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Acetylcholine chloride (Ach) (Invitrogen, US) in doses as indicated in the text were given in normoxia or 0.2% hypoxia.
-
bioRxiv - Neuroscience 2019Quote: ... Potassium chloride (Fisher Scientific, P330-500) was dissolved in Neurobasal media ...
-
bioRxiv - Microbiology 2021Quote: ... iron (III) chloride (Acros Organics, 99+%), manganese (II ...
-
bioRxiv - Microbiology 2022Quote: ... 200 mM sodium chloride (Fisher Scientific), 50 mM TRIS Base (Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 68 mM sodium chloride (ThermoFisher Scientific), 70 mM Tryptone (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM potassium chloride (ThermoFisher Scientific), 58 mM sodium phosphate dibasic (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Calcium chloride is from Acros Organics. ICI-118551 is from Tocris Bioscience ...
-
bioRxiv - Systems Biology 2023Quote: ... benzoyl chloride (BC; 99%, ACROS Organics), and sodium hydroxide (NaOH ...
-
bioRxiv - Developmental Biology 2024Quote: ... precipitated with lithium chloride (9480G, Invitrogen) and EtOH ...
-
bioRxiv - Immunology 2021Quote: ... Red blood cells were then lysed by adding 3 ml of ammonium-chloride-potassium (ACK) lysis buffer (Invitrogen, Carlsbad, CA) for 4 min at room temperature ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2020Quote: Mouse ESCs and mEpiLCs were washed with cold DPBS (calcium chloride/magnesium chloride/) (PBS(+/+)) (Gibco 14040-133) and all cell types were lysed with Pierce™ RIPA Buffer (ThermoScientific 89900 ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 50 mg CG was dissolved in pyridine and 150 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 40 mg AG was dissolved in pyridine and 80 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
bioRxiv - Biochemistry 2022Quote: ... MSTFA + 1% TMCS Reagent (TS-48915) and pyridine (TS-27530) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was reconstituted in 50 µL of methoxyamine HCL in pyridine (Thermo Scientific, Pennsylvania) for 1.5 hours at 30 °C with stirring ...
-
bioRxiv - Physiology 2023Quote: ... USA) with exception of the pyridine and methoxyamine hydrochloride (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: Single- and double-stranded oligonucleotide substrates were diluted in TBST with 0.1% BSA and 3 mM magnesium chloride to 1 μM final concentrations Previously mentioned enzymes and RNase A (EN0531, Thermo Fisher) were used at a 1:200 final dilution and incubated with indicated nucleic acid substrates for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Enzymatic treatments were done in staining buffer supplemented with 3 mM magnesium chloride with 1:200 dilutions of RNase T1 (EN0541, Thermo Fisher), RNase III (ShortCut RNase III ...
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).
-
bioRxiv - Microbiology 2021Quote: ... 1 mL aliquots of the BLEB enrichments were serially diluted to 10-3 in phosphate buffered saline (PBS; 1M; potassium chloride [Fischer Chemical], potassium phosphate [Acros Organics] ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Systems Biology 2020Quote: ... and the cells were rinsed with Phosphate-buffered saline without calcium chloride and magnesium chloride (PBS0, Life Technologies) prior to the addition of Trypsin-LE (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... in 0.01 M PBS (sodium chloride, potassium chloride, sodium phosphate dibasic, potassium phosphate monobasic, Fisher Scientific, Pittsburgh, PA), pH 7.3 ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Genomics 2021Quote: ... 0.23 μL magnesium chloride (1 M, Ambion), 0.48 μL Recombinant RNAse Inhibitor (40 U/μL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 21mg/L Zinc chloride (ZnCl2, Acros Organics), 20mg/L Cobalt (II ...
-
bioRxiv - Immunology 2021Quote: ... and 2 M sodium chloride solution (Invitrogen). The cDNA quality and concentration was determined with the Fragment Analyzer (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3M Guanidine chloride (ThermoFisher Scientific, 15502-016), and 70mM TCEP-HCl (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 3M Guanidine chloride (ThermoFisher Scientific, 15502-016), and 70mM TCEP-HCl (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Potassium Chloride (Fisher Scientific- 7447-40-7) and Calcium chloride (Fisher Scientific- 10043-52-4).
-
bioRxiv - Microbiology 2022Quote: Sodium chloride (Fisher Scientific, catalog #: S271-1).
-
bioRxiv - Microbiology 2021Quote: ... Ammonium chloride was purchased from Fisher Scientific. Dyngo-4a was purchased from Abcam ...
-
bioRxiv - Genomics 2020Quote: ... sodium chloride (NaCl, Thermo Fisher Scientific, S271500), Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA ...
-
bioRxiv - Immunology 2021Quote: ... Ammonium-Chloride-Potassium (ACK) lysis (Life Technologies) was additionally performed on spleen and blood samples ...