Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 METHOXY 2 METHYL 1 PHENYLSULFONYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1h at room temperature before rinsing and incubation with streptavidin-HRP (SNN1004, Invitrogen, 1:5000) 30 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by PBS washes (3x) and staining with Hoechst (Life Technologies, 1h, 1:10000 in PBS). Cells were imaged using a 20x water immersion objective on a high content confocal microscope (Molecular Devices™ ImageXpress Micro XL).
-
bioRxiv - Synthetic Biology 2019Quote: ... cells were incubated with a goat anti-rabbit secondary antibody (Alexa 633, Invitrogen; 1:100, 1h) and then analysed by a Fluorescence Activated Cell Sorter (Aria III ...
-
bioRxiv - Cell Biology 2022Quote: ... and goat anti-mouse Alexa Fluor 488 secondary antibody (1:500, 1h; A-21121, Invitrogen, Germany) were used ...
-
bioRxiv - Genomics 2022Quote: ... primary incubation was performed for 1h (anti-fibrillarin monoclonal mouse, 1:100, MA3-16771, Thermo Scientific), followed by incubation with secondary antibody (anti-mouse monoclonal FITC ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2019Quote: ... N-((2-(iodoacetoxy)ethyl)-N-Methyl)- amino-7-Nitrobenz-2-Oxa-1,3-Diazole (IANBD ester) and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then pegylated for 15 minutes with 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) before grids.
-
bioRxiv - Zoology 2023Quote: ... stained with 4′,6-diamidino-2-phenylindole (DAPI) (1:2000 dilution) and Alexa Fluor-conjugated donkey-anti-mouse (Molecular Probes, 1:1000), in PBST at room temperature for 2 hours ...
-
bioRxiv - Zoology 2024Quote: ... Tissue samples were subsequently rinsed three times with DPBS again and then transferred onto microscope slides in mounting buffer containing 1:1 DPBS: glycerol and 1µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes, Eugene, OR) to stain cell nuclei in prepared tissues and examined under a Lumen Dynamics XCite™ 120Q Nikon fluorescence microscope (Nikon ...
-
bioRxiv - Neuroscience 2022Quote: ... the brains were immersed in a 1:1-mixture of ethanol and methyl salicylate (Fisher Scientific GmbH, Schwerte, Germany) for 20 min and then in 100% methyl salicylate for about 1 h at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... burnetii (1:2500; Robert Heinzen, NIH, Hamilton, MT) for 1h followed by Alexa fluor secondary antibodies (1:1000; Life Technologies) for 1 h ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Immunology 2022Quote: ... and 250nM tetramethyl rhodamine methyl ester (TMRM, ThermoFisher) for 30 minutes at 37°C prior to extracellular staining and flow cytometry ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM methyl-β-cyclodextrin (Acros Organics, NJ) (mβCD ...
-
bioRxiv - Immunology 2024Quote: ... 100 nM tetramethylrhodamine methyl ester (TMRM, ThermoFisher Scientific). 500 nM CellROX or 1 μM MitoSOX in HBSS at 37°C for 20 min ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells (2 × 105) were plated in 6 well culture dishes (Nunc™ ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI, 0.1 mg/ml, D1306; Molecular Probes) was added into the incubation solution to visualize cell nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, CA, USA) was used to stain cell nuclei ...
-
bioRxiv - Molecular Biology 2020Quote: ... Day 6-10 media contained 2% B27 supplement with insulin (Gibco) and BMP4 and FGF2 at previous concentrations ...
-
bioRxiv - Systems Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) containing mounting medium (Thermo Fisher Scientific). The results were detected using fluorescence microscopy (Leica ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6-diamino-2-phenylindole (DAPI; Cat# D1306, ThermoFisher Scientific, Waltham, MA) to exclude dead cells and analyzed on an LSR-II Flow Cytometer (BD Biosciences) ...
-
bioRxiv - Systems Biology 2021Quote: ... and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... blotted for 2-6 s in a VitroBot (Mark IV, ThermoFisher) at 4 °C and 100% humidity ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA) staining solution and mounted with cover glass ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...