Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6 Heptenoic acid 7 2 cyclopropyl 4 4 fluorophenyl 3 quinolinyl 3 5 dihydroxy calcium salt 1 1 3R 5S 6E since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI – D1306, Life Technologies, 1:50000) fluorescent secondary antibodies were used in all immunocytochemistry experiments where applicable ...
-
bioRxiv - Physiology 2020Quote: ... and DAPI (4’,6-diamidino-2-phenylindole, 1 μg ml1; ThermoFisher, #D1306) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and counterstaining with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher, 1:10000) and phalloidin (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DAPI (4, 6-diamidino-2-phenylindole dihydrochloride; Invitrogen, D1306, 1:500).
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ml of 1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Life Technologies). Sf9 insect cells (ATCC CRL-1711 ...
-
bioRxiv - Bioengineering 2022Quote: ... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) 1 M was purchased from Gibco (Waltham, MA), sodium chloride 5 M was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... in a proportion of 4:3:2 using Lipofectamine 2000 (ThermoFisher). HEK293T cells were maintained in DMEM complete medium (DMEM [Gibco] supplemented with 10% of FBS and 100 UI of Penicillin/Streptomycin) ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was visualized using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco, Germany #15630056), 2.5 ng/ml human fibroblast growth factor-basic (hFGF2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 10% human serum (Valley Biomedical ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 10% human serum (Valley Biomedical ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole or TO-PRO-3 (Thermo Fisher Scientific) staining.
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM FluoZin-3 tetrapotassium salt (Thermo Fisher Scientific, Waltham, MA) was then added to each reaction ...
-
bioRxiv - Immunology 2019Quote: ... 3-4 drops of blood were collected in 1 mL MEM medium (Gibco) supplemented with 2000 U/L heparin (Ratiopharm) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).