Labshake search
Citations for Thermo Fisher :
101 - 150 of 4311 citations for 6 Heptenal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After PBS washing ...
-
bioRxiv - Neuroscience 2023Quote: ... Essential 6(tm) Medium (Thermo Fisher) was added to the culture for 2 days followed by addition of neural induction media (Advanced DMEM/F-12 (1:1) ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (Invitrogen, #88-7066-88), IL-8 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (Invitrogen, #88-7064-22), and IL-1β (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Plant Biology 2023Quote: ... and QuantStudio 6 (Thermo Fisher Scientific). Gene-specific primer sets (Supplemental Table 3 ...
-
bioRxiv - Bioengineering 2023Quote: ... on a QuantStudio 6 (Applied Biosystems, QuantStudio Real-Time PCR software v.1.3) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The QuantStudio 6 system (ThermoFisher Scientific) was employed for running the qRT-PCR experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Hoescht 33342 (6 µg/mL; Invitrogen) was used to identify nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... coated 6-well plates (Nunc, Denmark).
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibody solution ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). BAC controls were obtained from BACPAC company ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). See Supplementary Data for primers.
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... pH 6 (Fisher Scientific, Illkirch, France) at 96°C in a Pre-Treatment Module (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). Antibodies used for immunoprecipitation were ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). Antibodies used for immunoprecipitation were ...
-
bioRxiv - Microbiology 2024Quote: ... in a QuantStudio 6 Flex (ThermoFisher). ΔCT for each primer pair was determined by subtracting the individual CT value from the CT value of seryl-tRNA synthetase (PF3D7_0717700 ...
-
bioRxiv - Immunology 2024Quote: ... on a QuantStudio 6 (Thermo Fisher) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... in Essential 6 medium (Gibco, A1516401) supplemented with two SMAD pathway inhibitors – dorsomorphin (2.5 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... IL6 (encodes Interleukin 6; ThermoFisher, Hs00174131_m1) and the housekeeping gene TBP (ThermoFisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After washing slides were mounted in Elvanol ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Genomics 2020Quote: ... on the QuantStudio 6 Flex (Life Technologies). Next ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). Samples were analyzed using a two-step amplification and melt curves were obtained after 40 cycles ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). The Ct values were analyzed by the enrichment compared to input method.
-
bioRxiv - Bioengineering 2019Quote: ... Novex TBE - DNA retardation gels (6%) – (ThermoFisher) were used for the electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 µL of sterile medium added below the insert (Stoppini et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 6’-diamidino-2 phenylindole (DAPI) (Life Technologies), and visualized on a Nikon TiE fluorescent microscope using 60X oil immersion objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.