Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Hepten 4 yn 3 ol 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... differentiated OLs at 6 DIV (‘OL 3 days’) were transfected with plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibodies solution ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibody solution ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... Succinimidyl 6-(4, 4’-azipentanamido)hexanoate (LC-SDA; Thermo Scientific) crosslinking was performed by adding the reagent to final 1mM concentration ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with DAPI (4’,6-diamidino-phenylindole, Invitrogen) for 45 min (both steps at room temperature) ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D3571) was added for 5 minutes in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...