Labshake search
Citations for Thermo Fisher :
501 - 550 of 6735 citations for 6 HYDROXY 7 METHYLPURINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Molecular Probes, Eugene, OR, USA). Conidia were incubated in an optimized minimal medium for 20 h at 25°C ...
-
bioRxiv - Genomics 2021Quote: ... on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). DNA contamination was assessed omitting the RT ...
-
bioRxiv - Molecular Biology 2021Quote: MCF-7 cells were maintained in RPMI media (11875093, Invitrogen) and MDA-MB-231 and 293T in DMEM media (MT10013CV ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Cell Biology 2020Quote: ... BMDC were differentiated for 7 days in RPMI (Life technologies) containing 10% v/v heat-inactivated foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... yeast cells were labeled with 7-Aminochloromethylcoumarin (CMAC; Life Technologies) at a concentration of 100 μM for 30 min in synthetic medium at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... on a Viia 7 Real-Time PCR System (ThermoFisher Scientific). The relative quantification of target mRNAs was performed using the LinRegPCR method [87] ...
-
bioRxiv - Cancer Biology 2022Quote: ... on the ViiA 7 Real-Time PCR System (Life technologies). Hprt ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplification was monitored on a QuantStudio™-7 (ThermoFisher Scientific) with cycle conditions consisting of enzyme activation (predenaturation ...
-
bioRxiv - Developmental Biology 2022Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). qRT-PCR Primers (targeting human genes unless otherwise noted):
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was run on a QuantStudio 7 Flex (Applied Biosystems) using 40ng cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... in a Viia 7 Real Time PCR System (Applied Biosystems). The following cycle conditions were used ...
-
bioRxiv - Immunology 2022Quote: ... in the ViiA 7 Real-Time PCR system (Applied Biosystems). The following TaqMan probes (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: COS-7 cells were transfected using Lipofectamine RNAiMAX (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... staining or Annexin V-Pacific Blue/7-AAD (Invitrogen/eBioscience) staining followed by fluorescent activated cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Amplification was performed on QuantStudio 7 Flex® (Applied Biosystems). Beta-actin was used as an endogenous control for normalisation of target genes ...
-
bioRxiv - Immunology 2020Quote: ... in a ViiA 7 Real-Time PCR system (Applied Biosystems). The relative expression of target genes was confirmed using the quantity of target gene/quantity of GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). The copy number for each transcript is expressed relative to that of housekeeping gene HPRT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7 ppm (v/v) β-mercaptoethanol (Life Technologies, 21985-023), 4 ng/mL bFGF (Peprotech ...
-
bioRxiv - Immunology 2022Quote: ... and IL-13 (Alexa Fluor 488, or PeCyanine 7, Invitrogen; or eFluor 660 ...
-
bioRxiv - Immunology 2022Quote: ... cells were stained with CellEvent Caspase-3/7 Green (Invitrogen). The cytotoxicity was assessed by flow cytometry as the percentage of Caspase 3/7+ cells in the target cell population ...
-
bioRxiv - Immunology 2022Quote: ... stained for apoptosis with CellEvent Caspase-3/7 (Thermo Fisher), incubated for additional 30 min ...
-
bioRxiv - Pathology 2019Quote: ... on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). PCR primers were designed to specifically amplify genes of interest (table S2) ...
-
bioRxiv - Genomics 2019Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher). Analysis was performed using the ΔΔCt method (Livak and Schmittgen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Granzyme B (effector T cells, GRB-7, Thermo Fisher Scientific), CD68 (macrophages ...
-
bioRxiv - Immunology 2020Quote: ... or Annexin V cell apoptosis kit with 7-AAD (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Analysis was performed with ViiA™ 7 Software (Thermo Fisher). The fold change gene expression in the fetal corneas at 9 wg ...
-
bioRxiv - Microbiology 2020Quote: ... and run on a QuantStudio 7 Flex instrument (Applied Biosystems) under the following cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... using the ViiA-7 Real-Time PCR system (Applied Biosystems), and the expression levels were normalized to GAPDH.
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... 2’,7’-Dichlorodihydrofluorescein diacetate (Thermo fisher, Shanghai, China, cat# 2938), JC-1 probe solution (Sigma ...
-
bioRxiv - Immunology 2019Quote: ... Monocytes were incubated for 7 days with RPMI-1640 (Gibco) supplemented with 100 ng/ml MCS-F (#300-25-100 ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Physiology 2021Quote: ... in the ViiA 7 Real-Team PCR System (Thermo Fisher) with the following times ...
-
bioRxiv - Physiology 2020Quote: ... 7-AAD or fixable viability dye eFluor780 (Thermo Fisher Scientific) served as a live-dead stain ...
-
bioRxiv - Physiology 2021Quote: ... in a ViiA 7 Real-Time PCR System (Applied Biosystems) using ViiA 7 Software (Applied Biosystems).
-
bioRxiv - Genomics 2021Quote: ... (7) we relaxed the filtering criterion used by Thermo Fisher Scientific and selected the best markers in the remaining set ...
-
bioRxiv - Bioengineering 2021Quote: ... using the ViiA™7 RT-PCR System (Applied BioSystems). Quantification was performed by calculating the ΔCt value using GAPDH as a reference and results are shown as mRNA expression levels (2-ΔCt ...
-
bioRxiv - Genetics 2021Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). Four technical replicates were pipetted on a 384-well plate using the JANUS automated workstation (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences are listed below.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 7% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mmol/L Glutamax (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle.
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 and COS-7 cells and Lipofectamine 2000 (Thermo Fisher) reagent for NIH3T3 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... on microscopy plates (Cat. #12-544-7, Thermo Fisher Scientific), and sealed with nail polish (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... on ViiA™ 7 Real-Time PCR System (Applied Biosystems) using Platinum™ SYBR™ Green qPCR SuperMix-UDG w/ROX (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). 18S rRNA served as the internal control ...
-
bioRxiv - Cell Biology 2022Quote: ... on QuantStudio 7 Flex Real time PCR system (Applied Biosystems). Reactions were performed in triplicate and RNA expression was normalised to 36b4 ...
-
bioRxiv - Cell Biology 2022Quote: ... using a ViiA-7 Real-Time PCR system (Applied Biosystems). Fold change in expression was calculated by the ΔΔCt method using actin as a control ...
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...