Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 Fluoroindole 3 Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 10% acetonitrile (LC/MS grade, Thermo Scientific), and 5% water ...
-
bioRxiv - Cell Biology 2023Quote: ... in acetonitrile (Optima-Grade, Thermo Fisher Scientific). Samples were vortexed and kept at 20°C until analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... The percentage of acetonitrile (ACN) (Thermo Fisher) was increased from 0 to 17.5 % over two-thirds of the gradient length and from 17.5 % to 35 % in the last third ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Peptides were gradient eluted at 300 nL/minute from 3% to 20% acetonitrile over 100 min into an Orbitrap Fusion mass spectrometer (Thermo Scientific). Precursor mass spectra (MS1 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Peptides were eluted at 300 nL/minute using a gradient from 3% to 20% acetonitrile over 100 minutes into an Orbitrap Fusion mass spectrometer (Thermo Scientific). Precursor mass spectra (MS1 ...
-
bioRxiv - Cell Biology 2021Quote: ... the peptides were resuspended in 3% formic acid (FA)/5% acetonitrile (ACN) and loaded onto a nanoLC system (RSLCnano, Thermo Scientific). First ...
-
bioRxiv - Bioengineering 2020Quote: ... Cisapride and norcisapride were further separated by a gradient mode of 10 mM ammonium acetate-acetonitrile as mobile phase using Acclaim Trinity P1 reverse phase column (2.1 × 50mm, 3 μm; Thermo Fisher Scientific). Mass ion transitions (Q1/Q3 ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
bioRxiv - Plant Biology 2019Quote: The peptides were dissolved in 5 μL of 0.3% formic acid with 3% acetonitrile and injected into an Easy-nLC 1200 (Thermo Fisher Scientific). Peptides were separated on a 25 cm Easy-Spray column (75 μm ID ...
-
bioRxiv - Microbiology 2022Quote: ... Resultant peptide-containing samples were resuspended in LC-MS injection buffer (3% acetonitrile and 0.1% formic acid) and analyzed on an Orbitrap Exploris™ 480 Mass Spectrometer (ThermoFisher Scientific) using liquid chromatography-tandem mass spectrometry (LC-MS/MS) ...
-
Pan-tissue mitochondrial phenotyping reveals lower OXPHOS expression and function across tumor typesbioRxiv - Biochemistry 2023Quote: ... of 3 to 30% acetonitrile using a 2□μm EASY-Spray PepMap RSLC C18 75□μm × 250□mm column (Thermo Fisher) with a column temperature of 55□°C ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Immunology 2019Quote: ... eluted in 40 μL acetonitrile 70% (Fisher Scientific)/0.1% formic acid ...
-
bioRxiv - Biochemistry 2020Quote: ... and acetonitrile (ACN) were purchased from Fisher Scientific, Inc ...
-
bioRxiv - Biochemistry 2020Quote: ... and acetonitrile were all purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 60% acetonitrile (MeCN) (LC/MS grade, Fisher Scientific), followed by two washes with 0.1% (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... 30% (v/v) acetonitrile (ACN, Thermo Fisher Scientific) and 0.1 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and buffer B: 80% acetonitrile (Fisher Scientific, A955) in 0.1% formic acid ...
-
bioRxiv - Molecular Biology 2020Quote: - LC/MS grade acetonitrile (Cat# A955, Fisher Scientific)
-
bioRxiv - Biochemistry 2021Quote: ... acetonitrile and methanol were purchased from Fisher Scientific. [U-13C6]-glucose and [U-13C6]-glutamine were obtained from Cambridge Isotope Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... methanol and acetonitrile were sourced from Fisher Scientific, USA.
-
bioRxiv - Microbiology 2022Quote: ... methanol and acetonitrile were sourced from Fisher Scientific, USA.
-
bioRxiv - Neuroscience 2023Quote: ... in 80% acetonitrile/20% H2O (Thermo Fisher Scientific). Peptides passed through an Acclaim PepMap C18 100Å ...
-
bioRxiv - Cell Biology 2023Quote: ... methanol and acetonitrile were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Mobile phase B was 100% acetonitrile (Thermo Fisher). The column was washed with mobile phase A for 10 min followed by gradient elution 0-50% B (10-60 min ...
-
bioRxiv - Biochemistry 2023Quote: ... mass spectrometry grade acetonitrile (Thermo Fisher Scientific, USA), mass spectrometry grade purified water (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Acetonitrile for mass spectrometry (Thermo Fisher Scientific, USA), Purified water for mass spectrometry (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Acetonitrile for mass spectrometry (Thermo Fisher Scientific, USA), Purified water for mass spectrometry (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Acetonitrile for mass spectrometry (Thermo Fisher Scientific, USA), Purified water for mass spectrometry (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Mobile phase A contained 10% acetonitrile (Fisher Scientific) and 0.1% medronic acid (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were reconstituted in LC-MS injection buffer (3% acetonitrile, 0.1% formic acid) and quantified by Pierce Quantitative Fluorometric Peptide Assay (Thermo Scientific, Product #23290).
-
bioRxiv - Pathology 2023Quote: Dried peptide samples were dissolved in 4.8 μL of 0.25% formic acid with 3% (vol/vol) acetonitrile and 4 μL of each sample was injected into an EasynLC 1000 (Thermo Fisher Scientific). Peptides were separated on a 45 cm in-house packed column (360 μm OD×75 μm ID ...
-
bioRxiv - Neuroscience 2023Quote: The full phosphopeptide sample was dissolved in 10.5 μL of 0.05% trifluoroacetic acid with 3% (vol/vol) acetonitrile and 10 μL of each sample was injected into an Ultimate 3000 nano UHPLC system (Thermo Fisher Scientific). Peptides were captured on a 2-cm Acclaim PepMap trap column and separated on a 50-cm column packed with ReproSil Saphir 1.8 μm C18 beads (Dr ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Peptides were separated within a 25 min gradient (3 – 35% acetonitrile) on a monolith column (ProSwift™ RP-4H, 1 mm x 250 mm, Thermo Fisher Scientific) using an HPLC system (Agilent 1200 series ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by dilution with 15 μl methanol/acetonitrile (1:1 v/v) (optima LC-MS grade, Fisher Scientific, methanol, #A456; acetonitrile, #A955). Samples were centrifuged at 20,000 g for 10 min at 4°C and the supernatants were transferred to LC vials ...
-
bioRxiv - Neuroscience 2024Quote: Standards and samples were injected (10 µL) by an autoinjector using an acetonitrile based MD-TM mobile phase (10% acetonitrile: Thermo Fisher Scientific). HPLC flow rate was 0.6 mL / min ...
-
bioRxiv - Cancer Biology 2021Quote: ... lysed in 80% Ultra LC-MS acetonitrile (Thermo Scientific) on ice for 15 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 74.9% v/v acetonitrile (all Optima grade, Fisher Scientific aside from DMSO ...
-
bioRxiv - Biochemistry 2022Quote: ... and solvent B = 0.1% FA in acetonitrile (Thermo Fisher). Data were acquired at 2 Hz s-1 over the scan range 50 to 1700 m/z in the positive mode ...
-
bioRxiv - Microbiology 2019Quote: ... Optima™ LC-MS Grade Acetonitrile (CAN; Fisher Scientific), Optima™ LC-MS Grade Methanol (MeOH ...