Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6 Fluoro 2 methylindole 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Immunology 2023Quote: Cells were preincubated for 1 h with culture medium containing 250 μM biotin-glutathione ethyl ester (BioGEE, ThermoFisher), then treated as indicated ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated for 1 hour with the mitochondrial membrane potential dye tetramethylrhodamine ethyl ester (TMRE) (Invitrogen; # T668) at a final concentration of 100nM ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2021Quote: ... and FURA 2-AM (Fura-2-acetoxymethyl ester) from Invitrogen, CA ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 2 μM Fura-2 acetoxymethyl ester (Fura-2 AM; ThermoFisher Scientific) and 0.01% pluronic acid (Merck ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Biochemistry 2020Quote: In vivo Δψm was measured using the cell-permeant red-fluorescent dye TMRE (tetramethylrhodamine ethyl ester, Thermo Fisher Scientific). For each time point ...
-
bioRxiv - Neuroscience 2022Quote: Fura-2 pentaacetoxymethyl ester (fura-2/AM) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bis-(1,3-diethylthiobarbituric acid) trimethine oxonol (DiSBAC, relative polarization) and CoroNa green, acetoxymethyl ester (CoroNa, sodium ions) were purchased from Invitrogen (Waltham, MA).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Cell Biology 2023Quote: The ROS dye assay was performed using Di(Acetoxymethyl Ester) (6-Carboxy-2’,7’-Dichlorodihydrofluorescein Diacetate) ROS dye (Invitrogen, D23844), a fluorogenic dye that is converted to 6-CarboxyFluorescein ...
-
bioRxiv - Pathology 2021Quote: ... pentaacetoxymethyl ester (Fluo-3/AM) (Molecular Probes, Eugene, OR, USA), which was observed with the laser-scanning confocal microscopy (LSCM ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Physiology 2022Quote: ... The mitochondria membrane potential was also assessed in cells stained with 50 nM tetramethyl rhodamine ethyl ester (TMRE, ThermoFisher, T669) and subsequently collected in HBSS containing 5 mM EDTA ...
-
bioRxiv - Neuroscience 2022Quote: ... y229Gt (Tg(tnks1bp1:EGFP)) transgenic larvae were exposed to 250 nM tetramethylrhodamine ethyl ester perchlorate (TMRE, Thermo Fisher, Cat# T669) diluted in EM for 25 minutes while wrapped in foil ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cardiomyocytes were loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously.28 After Fura-2 loading ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... DiI (1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, dissolved in 70% ethyl-alcohol; Invitrogen), for fluorescent marking aimed to track their position post-mortem ...
-
bioRxiv - Cell Biology 2023Quote: ... then counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Asc-citrine photographs were taken using ZEISS microscopy (Carl Zeiss Industrial Metrology ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescently tagged G-actin was prepared by covalent modification with Alexa Fluor™ 594 Carboxylic Acid (Thermo Fisher Scientific 15461054) (Alvarado and Koenderink ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Myocytes were then loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously (Batiste et al. ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Immunostaining images were taken using a Leica inverted microscope with a TCS SPEII confocal module and processed using LAS X software (Leica Microsystems Inc ...
-
bioRxiv - Zoology 2019Quote: ... containing 5 µM Fura-2 acetoxymethyl ester (Molecular Probes, Invitrogen) for 30 min at room temperature ...
-
bioRxiv - Zoology 2019Quote: ... containing 5 µM Fura-2 acetoxymethyl ester (Molecular Probes, Invitrogen) for 30 min at room temperature ...