Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 Fluoro 1 3 benzodioxene 8 carbonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclear extracts were resolved using 3–8% Tris-Acetate gradient gels (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... Worm extracts were loaded on NuPAGE 3-8% Tris Acetate gels (Invitrogen). Proteins were then transferred onto nitro-cellulose membranes which were incubated with 1 µg/µL primary antibodies in 1X TBS-Tween (TBS-T ...
-
bioRxiv - Genetics 2023Quote: ... Protein was separated on 3 to 8% NuPAGE Tris-Acetate gel (Invitrogen) and transferred to PVDF membrane ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were subsequently loaded onto NuPAGE™ 3–8% Tris-Acetate (Invitrogen) and NativePAGE™ 4–16% ...
-
bioRxiv - Genetics 2024Quote: ... and separated by 3–8% NuPAGE™ Tris-Acetate gels (EA0375BOX, Invitrogen). Then the resolved proteins were transferred to 0.45 μm PVDF membranes (Merck Millipore ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2022Quote: ... and Alexa Fluoro-488 goat anti-rabbit IgG (H+L) (Invitrogen, A11034) in wash solution for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... donkey Alexa Fluoro 647-conjugated anti-goat IgG (#A11001; Thermo Fisher Scientific), and goat Alexa Fluoro488-conjugated anti-rabbit IgG (#A11001 ...
-
bioRxiv - Physiology 2020Quote: ... 9 mM magnesium chloride (MgCl2, Invitrogen), 1 μ Template-Switching Oligo (Exiqon ...
-
bioRxiv - Neuroscience 2020Quote: ... magnesium chloride and magnesium sulfate (Gibco) for 27 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Acetylcholine chloride (Ach) (Invitrogen, US) in doses as indicated in the text were given in normoxia or 0.2% hypoxia.
-
bioRxiv - Neuroscience 2019Quote: ... Potassium chloride (Fisher Scientific, P330-500) was dissolved in Neurobasal media ...
-
bioRxiv - Microbiology 2021Quote: ... iron (III) chloride (Acros Organics, 99+%), manganese (II ...
-
bioRxiv - Microbiology 2022Quote: ... 200 mM sodium chloride (Fisher Scientific), 50 mM TRIS Base (Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 68 mM sodium chloride (ThermoFisher Scientific), 70 mM Tryptone (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM potassium chloride (ThermoFisher Scientific), 58 mM sodium phosphate dibasic (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Calcium chloride is from Acros Organics. ICI-118551 is from Tocris Bioscience ...
-
bioRxiv - Systems Biology 2023Quote: ... benzoyl chloride (BC; 99%, ACROS Organics), and sodium hydroxide (NaOH ...
-
bioRxiv - Developmental Biology 2024Quote: ... precipitated with lithium chloride (9480G, Invitrogen) and EtOH ...
-
bioRxiv - Immunology 2021Quote: ... Red blood cells were then lysed by adding 3 ml of ammonium-chloride-potassium (ACK) lysis buffer (Invitrogen, Carlsbad, CA) for 4 min at room temperature ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 1 mM EDTA pH 8 (ThermoFisher)) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mM EDTA pH 8 (Invitrogen), 0.5 mM EGTA pH 8 (BioWorld) ...
-
bioRxiv - Genetics 2022Quote: ... These pieces were transferred to the lower surface of a 25 cm2 culture flask (6-8 pieces per flask) which had been pre-moistened with 1-2 mL of AmnioMAX Complete Medium (Thermo Scientific, #11269016) supplemented with 1% penicillin/streptomycin (GenDepot ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were stained according to the same protocol as adult spinal cords using anti-2H3 (1:300, DHSB AB2314897) and Alexa fluoro-568 anti-mouse (1:250, Thermo Scientific, A-21124). Images were taken using a 20x lens on a Zeiss Axio Scan Z1 slide scanner ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Bioengineering 2023Quote: ... ODCs were first generated by dissociating Day 6-8 PPTO.46 PDOs with TrypLE (Gibco) dissociation solution for 30-40 minutes in an incubator ...
-
bioRxiv - Bioengineering 2023Quote: ... for PEG-RGDS and 6-8 kDa MWCO dialysis membrane for PEG-PQ-PEG (Thermofisher), then lyophilized ...
-
bioRxiv - Cell Biology 2020Quote: Mouse ESCs and mEpiLCs were washed with cold DPBS (calcium chloride/magnesium chloride/) (PBS(+/+)) (Gibco 14040-133) and all cell types were lysed with Pierce™ RIPA Buffer (ThermoScientific 89900 ...
-
bioRxiv - Molecular Biology 2019Quote: ... with the exception of the use of NuPAGE Tris-Acetate (3-8%, ThermoFisher) protein gels to ensure proper separation of the large NIPBL protein ...
-
bioRxiv - Biochemistry 2021Quote: ... with 50ug of protein separated using 3-8% tris-acetate gels (Invitrogen EA0378) and transferred using an iBlot2 transfer system (Invitrogen IB21001) ...
-
bioRxiv - Systems Biology 2021Quote: ... APC was separated by Tris-Acetate 3-8% precast gels (NuPAGE Novex, Invitrogen). The proteins were transferred into nitrocellulose membranes by electrophoretic transfer.
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Cdc7-HA were resolved on 3-8% Tris-Acetate gels (Invitrogen EA0375) at 150V for 1 hour ...
-
bioRxiv - Genomics 2019Quote: ... Proteins were separated on NuPAGE 3-8% Tris-Acetate Protein Gels (Thermo Fisher). The primary antibodies used were mouse anti-CAS9 (7A9-3A3 ...
-
bioRxiv - Cell Biology 2021Quote: ... homogenised samples were run on 3-8% Tris-Acetate gels (Thermo Scientific Technologies), blotted onto PVDF membrane (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were separated on NuPAGE 3-8% Tris-Acetate (Thermo Fisher Scientific, EA0375BOX) or 4-20% TGX (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... Samples were loaded into 3-8% Tris-acetate gels (Thermo Fisher, CAT#EA03752BOX) and ran in sample running buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (ThermoFisher) transferred to nitrocellulose membrane ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... resolved by SDS-PAGE on 3-8% tris-acetate precast gels (ThermoFisher Scientific), followed by protein staining with InstantBlue (Bio-Techne AG) ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...