Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 FLUORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... methyl ester (TMRM) (Cat# I34361, Invitrogen) and 1ug/ml Hoechst 33342 (Cat# H3570 ...
-
bioRxiv - Immunology 2021Quote: ... methyl ester (TMRM; Invitrogen cat #T668) in serum-free RPMI media for 45 minutes at 37°C per manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Tetramethylrhodamine methyl ester perchlorate (TMRM, Invitrogen) was used to stain cells at concentrations of 50 or 10 nM ...
-
bioRxiv - Microbiology 2023Quote: ... MES and methyl-salicylate (ACROS Organics); sodium ferulate (Selleck Chemical) ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl ester (TMRM, Thermo Fisher Scientific). Cells were loaded with 20 nM TMRM for 30 minutes at 37°C and then transferred to the imaging system ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: ... green nanospheres (200 nm, 1% solids, Fluoro-Max, Thermo Scientific, CA, US) were premixed in the gelatin (1:20 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Alexa Fluoro-488 goat anti-rabbit IgG (H+L) (Invitrogen, A11034) in wash solution for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... donkey Alexa Fluoro 647-conjugated anti-goat IgG (#A11001; Thermo Fisher Scientific), and goat Alexa Fluoro488-conjugated anti-rabbit IgG (#A11001 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotech ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 4-6 days with Versene solution (Gibco). A control iPS cell line (MIN09i-33114.C ...
-
bioRxiv - Immunology 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, CA, USA) was used to stain cell nuclei ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and sectioned (4-6 micron) using a Microm HM 325 (ThermoFisher). Tissue sections were then stained with Weigert’s iron hematoxylin and Masson Trichrome (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg plasmid and 6 µl Turbofect (Thermo Fisher Scientific, USA) were combined ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...