Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 FLUORO 2 METHYLQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead MyOne carboxylic acid (Invitrogen), 1M MgCl2 (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa 405 carboxylic acid (Invitrogen, #A30000) and Cy3 mono-reactive dye pack (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... of Dynabeads M-270 Carboxylic acid (Invitrogen) by using a two-step coating procedure with EDC and NHS as indicated by the manufacturer ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor 647 carboxylic acid (Invitrogen, #A20006). The extent of co-localization of STIM1 and JPH4 was determined with the same primary antibodies as in PLA experiments (Table S1) ...
-
bioRxiv - Biophysics 2022Quote: ... and PEG 20k (15% w/v) supplemented with 3 μM Alexa 546 dye (carboxylic acid, ThermoFisher). The protein solution consisted of 70 μM HMGA1a supplemented with 10 μM Alexa647-labelled HMGA1a ...
-
bioRxiv - Developmental Biology 2020Quote: ... was captured using a GFP binding protein (GBP) covalently conjugated to carboxylic acid decorated Dynabeads (Dynabeads M-270 carboxylic acid, Thermo Fisher Scientific). Untagged SMO (Fig ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... Dynabeads M-270 carboxylic acid (14305D, Thermo Fisher Scientific) were then added (2 µg/µl final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed as previously reported (Borgman et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... Dynabeads M-270 Carboxylic Acid were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2022Quote: ... Alexa546 and Alexa647 carboxylic acid were obtained from Thermo Fisher. PEG 4000 and 6000 were from Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.01mg/ml Alexa Fluor 594 carboxylic acid (Thermo Fisher, A33082) was dissolved in the patch pipette solution ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μm Dynabeads (Dynabeads MyOne Carboxylic acid #65011, Thermo Fisher Scientific) were added to the cells at a dilution of 1:20 ...
-
bioRxiv - Biophysics 2020Quote: ... an aliquot of 100 μL carboxylic acid paramagnetic Dynabeads M-270 (Invitrogen) and 10 μL of 5 mg∙mL−1 of protein A (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: Alexa 488 carboxylic acid was obtained as lyophilized powder from Thermo Fisher. Stock solutions at millimolar concentrations were prepared in dimethyl sulfoxide and further diluted in PBS buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... consisting of 22 μM NSP5 supplemented with 6.4 μM Alexa647 dye (carboxylic acid, ThermoFisher) or 8 μM His-tagged NSP2 labelled with 8 μM Atto488-nitrilotriacetic acid (NTA ...
-
bioRxiv - Systems Biology 2021Quote: ... and Dynabeads MyOne Carboxylic acid were obtained from Thermo Scientific (San Jose, CA, USA). FG beads COOH and FG beads NH2 were from TAMAGAWA SEIKI (Nagano ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were cleaned up using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 17% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Immunology 2023Quote: ... were randomly conjugated with Alexa Fluor 647 carboxylic acid succinimidyl ester (Thermo Fisher Scientific) and EZ-Link™ NHS-LC-LC-Biotin in a 1 to 2 molar ratio (protein:dye and protein:biotin ...
-
bioRxiv - Biophysics 2023Quote: ... Monomeric (G)-actin was fluorescently labeled with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen) (62) ...
-
bioRxiv - Cell Biology 2019Quote: ... By adding a tracer dye (0.5 μg/mL Alexa Fluor 647 carboxylic acid; Life Technologies) to the sorbitol-supplemented medium ...
-
bioRxiv - Immunology 2021Quote: ... human cGAS was labelled with AlexaFluor-488 (AF488) carboxylic acid (succinimidyl ester) (Thermo Fisher Scientific) according to manufacturer’s manuals using a molar ratio of 1:10 at 4°C for 4 h ...
-
bioRxiv - Bioengineering 2020Quote: ... Alexa Fluor 555 carboxylic acid succinimidyl ester was obtained from Life Technologies (Carlsbad, CA, USA). Protein samples were labeled with Alexa Fluor 555 carboxylic acid succinimidyl ester according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... PAO1 was fluorescently stained using Alexa Fluor carboxylic acid succinimidyl esters (Alexa Fluor 488, ThermoFisher) as described previously (Friedlander et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dynabeads MyOne™ Carboxylic Acid and 100mM of each dNTP were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Wnt3a proteins were immobilized to 2.8 μm carboxylic acid–coated Dynabeads® (cat. num. 14305D, ThermoFisher), as described before (Habib et al. ...
-
bioRxiv - Immunology 2020Quote: ... The dyes were purchased as NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Genomics 2021Quote: ... Size-selection and cleanup were accomplished using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 11-11.5% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Biophysics 2023Quote: ... Carboxylated 1 μm paramagnetic beads were obtained from Thermo Fischer (Dynabeads MyOne Carboxylic Acid, ThermoFisher, USA). 5 μl of the bead solution were centrifuged ...
-
bioRxiv - Bioengineering 2024Quote: ... Concentration of C2 to C6 carboxylic acids and alcohols were analyzed by gas chromatography (Thermofisher, USA) using a Stabil-wax™ column with a length of 25 m and internal diameter of 0.2 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Bioengineering 2021Quote: Protein supernatants were then labelled with Alexa Fluor® 555 carboxylic acid succinimidyl ester (AF555) (ThermoFisher Scientific) essentially as previously described [76] ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The dyes used for labelling were NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled with AF647 (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). Proteins were dialyzed against Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Biochemistry 2023Quote: hSSB1 and INTS3 proteins were labeled using AF647 dye (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). The storage buffer was exchanged by dialysis to labeling buffer containing 50 mM MES pH 6.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...