Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Diazo 5 6 dihydro 5 oxo 1 naphthalenesulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Immunology 2020Quote: ... 5% CO2 for 6 days in RPMI (Life Technologies) supplemented with [5%] AB serum ...
-
bioRxiv - Biochemistry 2024Quote: ... NHS-5/6-carboxyfluorescein (NHS-fluorescein, Thermo Fisher 46410), NHS-Oregon Green (Thermo Fisher O6147) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Cell Biology 2019Quote: ... TaqMan primers 5′ end labeled with 6-carboxyfluorescein (FAM; ThermoFisher), and cDNA diluted per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Bioengineering 2021Quote: ... The 5(6)-Carboxyfluorescein N-hydroxysuccinimide was purchased from Thermo Fisher Scientific (ON ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 and 6 dpf with TRIzol reagent (Thermo Fisher Scientific, 15596018) and incubated at 37° C for 30 minutes with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 mL acid phenol: chloroform 5: 1 (Ambion), and 50 mL 0.5 mm zirconia/silica beads (BioSpec) ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Developmental Biology 2022Quote: ... with a 6-FAM™ fluorescent tag at its 5’ end (Life Technologies). Three primers PCR amplification were performed using the Qiagen Multiplex PCR kit (206143 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Cells were grown for 5–6 days in IMDM (Thermo Fisher Scientific, 12440053) supplemented with 1% non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Pathology 2022Quote: ... resulting from UA were determined via a membrane-permeant JC-1 dye (5, 50, 6, 60 -tetrachloro-1, 10,3,30 -tetraethylbenzimidazol-carbocyanine iodide, Molecular Probes). JC-1 dye accumulates in mitochondria in a potential-dependent manner ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Genomics 2021Quote: ... cells were seeded in 6-well plates or 6 cm dishes and reverse transfected with 5 nM Silencer Select siRNAs (Thermo Fisher Scientific) using RNAiMAX (Thermo Fisher Scientific ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...