Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Chloro 3 pyridineethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Plant Biology 2019Quote: To assess GUS expression driven by the maize ubiquitin promoter in transgenic barley transformed with the pBRACT214m-GUS construct we collected different tissues and stained these with 1mg/ml of X-gluc (5-bromo-4-chloro-3-indolyl-B-D-glucuronic acid, Thermo Scientific, USA) in X-gluc buffer (100mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7H11 plates contained 50 μg/mL hygromycin and 50 μM 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Thermo Scientific). Unless specified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... HCT8 cells were grown on a 6-well slide (3×105/well, Thermo Scientific) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells (3×105) were seeded in a 6 well plate (Nunc,Thermo,USA) with DMEM media (Invitrogen,USA ...