Labshake search
Citations for Thermo Fisher :
601 - 650 of 7388 citations for 6 CHLOROPYRAN 2H ONE 97 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed with one milliliter TRIzol Reagent (Ambion) and RNA and DNA were purified sequentially from half of the lysate using a Direct-zol DNA/RNA Miniprep kit (Zymo ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA quantification was performed using NanoDrop One (Thermo Scientific). Strand cDNA was generated by priming 1 μg of total RNA with a oligo (dT)16/random hexamers mix ...
-
bioRxiv - Microbiology 2023Quote: ... One Micro volume UV-Vis spectrophotometer (Thermo Scientific™). Using the PrimeScript first strand cDNA synthesis kit (Takara ...
-
bioRxiv - Plant Biology 2023Quote: ... A NanoDropTM One spectrophotometer (ThermoFisher Scientific, Waltham, MA, U.S.A.) was used to estimate RNA concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA concentration was measured using NanoDrop One (Thermo Scientific) and was in the range of 260 – 330 ng/µl for all samples prior to cDNA synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... in a Step One Plus Thermal Cycler (Applied Biosystems). The PCR starts with 95°C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: Bacterial transformation was performed in One ShotTM TOP10 (Invitrogen) for pDPL0 and pLG0 or Stbl3TM competent bacteria (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... SuperScript III Platinum One-Step qRT-PCR Kit (ThermoFisher) and TaqMan probes (ThermoFisher ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... samples were analysed with a NanoDropTM One Spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Following one washing step in PBS+2% BSA (Gibco), cell suspensions were incubated for 20 min on ice with TotalSeq™-C anti-human Hashtag oligos (HTOs ...
-
bioRxiv - Biophysics 2023Quote: ... and one Titan Krios with Falcon IV (Thermo Fisher) and Selectris energy filter (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and one unit of Platinum Taq DNA polymerase (Invitrogen). An IP experiment without adding antibody (mock ...
-
bioRxiv - Genetics 2023Quote: ... One Countess cell counting chamber slide (Cat#C10283 Invitrogen) per patient was prepared for counting cells and placed under the hood ...
-
bioRxiv - Cancer Biology 2024Quote: ... and concentrations were measured on a Nanodrop One (ThermoFisher). A total of 1 μg of RNA was used as input for cDNA synthesis reactions by using the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we used a Nanodrop One spectrophotometer (Thermo Scientific, USA).
-
bioRxiv - Immunology 2024Quote: ... CSFE labelling of lymphocytes (for which sorting purity was determined to be 97% via flow cytometry) prior to coculturing experiment was done using the CellTrace™ CFSE Cell Proliferation Kit (ThermoFisher Scientific; Cat# C34554) accordingly the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: ... 10μM EdU was added to the culture media for 2h prior to fixation and detection using the Click-iT™ EdU Alexa Fluor™ 647 Flow Cytometry Assay Kit (Thermo Fisher Scientific, C10424), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Microbiology 2019Quote: ... in which one uninfected male and one uninfected female were introduced in an arena (Petri Dishes 100 x 150 mm, Fisher Scientific, Ontario, Canada). For the second treatment ...
-
bioRxiv - Microbiology 2023Quote: ... were used as template in a one-step RT-PCR reaction with the SuperScrip IV One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) and primers that amplify coding sequences for Spike amino acids 614 and 655 (Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... An 800 bp fragment covering the ORF10 region was amplified by one-step RT-PCR using the SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) and the following primers (OL11F ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the RNA concentration was measured by UV spectroscopy (NanoDrop One Microvolume UV-Vis Spectrophotometer, ND-ONE-W, Thermo Fisher Scientific, Waltham, MA). Reverse transcription was performed using the iScript cDNA Synthesis Kit (1708891 ...
-
Probing Interactions of Therapeutic Antibodies with Serum via Second Virial Coefficient MeasurementsbioRxiv - Biophysics 2021Quote: ... Labeling efficiency was determined through UV-Vis spectroscopy (A280 and A494 measurements) on a Nanodrop One Microvolume Uv-Vis spectrometer (Thermo Scientific, ND-ONE-W) as well as through diffusion time (change from free dye to protein-bound dye) ...
-
bioRxiv - Immunology 2023Quote: ... DNA pellet was resuspended in TE buffer (10mM Tris HCl, 1mM EDTA, pH 7.5) and quantified using a NanoDrop™ One/One from Thermo Fisher (Waltham, MA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Plant Biology 2021Quote: ... Slides were then washed in 1× PBS twice for 10 minutes each and incubated for 2h with a goat anti-mouse Alexa Fluor 555 (Thermo Fisher Scientific, cat. no. A-21424) secondary antibody (1:500 dilution) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 2h incubation at room temperature with secondary antibody (Goat anti-mouse Alexa 488, A11011, Life technologies, 1:400 in PBS 1% BSA, 2% NGS) and finally washed with PBS (3 × 5 min).
-
bioRxiv - Neuroscience 2023Quote: ... followed by 2h incubation at room temperature with secondary antibody (Goat anti-mouse Alexa 488, A11011, Life technologies, 1:400 in PBS 1% BSA, 2% NGS) and finally washed with PBS (3 × 5 min).
-
bioRxiv - Cell Biology 2020Quote: ... then transformed into One Shot TOP10 competent cells (ThermoFisher Scientific). Each mutant construct was sequenced to ensure that no unintended mutations were introduced ...
-
bioRxiv - Biochemistry 2022Quote: ... one lane was dedicated to the prestained marker (Thermo Scientific™ PageRuler™ Plus Prestained Protein Ladder ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred microlitre 3,3′,5,5′-tetramethylbenzidine substrate (Thermo Fisher Scientific) was added to each well and incubated for 10-15 min ...
-
bioRxiv - Immunology 2019Quote: ... Greiner Bio-One 96-well plates (Fisher Scientific, Waltham, MA), positioned on a ceramic platform under vacuum ...
-
bioRxiv - Plant Biology 2019Quote: ... coli One Shot®Top10 cells (Invitrogen Corp., Carlsbad, CA) and purified from an overnight culture using DNA Mini prep kit (Qiagen Co. ...
-
bioRxiv - Genetics 2019Quote: ... we ordered one pre-designed probe (Hs04385285_cn) from Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... One microliter of RNase Cocktail Enzyme Mix (Thermo Fisher Scientific) was used to degrade the RNA in the sample ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA were measured (NanoDrop One, Thermo Fisher, Waltham, MA), normalized to 10ng/μL and then reverse transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2019Quote: ... on a Step One Plus Real Time PCR (Applied Biosystems) was performed ...